For shRNA treatment, endothelial cells were infected with lentiviral particles according to Addgene “plKO.1 Protocol” (http://www.addgene.org/tools/protocols/plko/ ). Cells were selected with puromycin (0.5 μg/ml). The PHF8 target sequence was: 5’- CCGGCCCAACTGTGAAGTCTTGCATCTCGAGATGCAAGACTTCACAGTTGGGTTTTTG -3’. Control shRNA against green fluorescent protein (shGFP) and shScrambled (shScr) were purchased from Addgene. For siRNA treatment, endothelial cells (80–90% confluent) were transfected with GeneTrans II according to the instructions provided by MoBiTec (Göttingen,Germany). siRNAs for PHF8 were purchased from Sigma (siPHF8-1: #SASI_Hs01_00079031, siPHF8-2: #SASI_Hs01_00079033, siPHF8-3, SASI_Hs01_00079032). siE2F4 was purchased from ThermoFisher Scientific (#114193 siE2F4-1 and #114194 siE2F4-2). Control siRNAs (siScrambled) were from Invitrogen (siScr-1: #12935–300, siScr-2: #12935112, siScr-3: #12935113). Plasmid overexpression was achieved with the Neon electroporation system (Invitrogen). The plasmid PHF8 (vector: pcDNA3) was kindly provided by Shi Yang (Harvard Medical School, Department of Cell Biology) [13 (link)], E2F1 and E2F4 (vector: pcDNA3) plasmids were from Addgene (24225# and #10914).
Shscrambled shscr
Manufactured by Addgene
ShScrambled (shScr) is a plasmid used for gene knockdown experiments. It contains a short hairpin RNA (shRNA) sequence that targets no known genes, serving as a control for non-specific effects in RNA interference (RNAi) studies.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using shscrambled shscr
1
Knockdown and Overexpression of PHF8 and E2F in Endothelial Cells
2
Efficient Knockdown and Overexpression in Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For shRNA treatment, endothelial cells were infected with lentiviral particles according to Addgene “plKO.1 Protocol” (http://www.addgene.org/tools/protocols/plko/ ). Cells were selected with puromycin (0.5 µg/ml). The shFlot-1A target sequence was: 5′-CAGAGAAGUCCCAACUAAUUA-3′, for shFlot-1B 5′-CUGCUUGGCUUUAGCUUCCCG-3′ and for m-shFlot-1 CAGGATTACTTACACTCGTTA. Unless otherwise noted, all experiments were performed with shFlot-1A. Target sequence for shFlot-2 was 5′-GUGCAGAGAGAUGCUGACAUU-3′. Control shRNA against green fluorescent protein (shGFP) and shScrambled (shScr) were from Addgene. For siRNA treatment, endothelial cells (80–90 % confluent) were transfected with GeneTrans II according to the instructions provided by MoBiTec (Göttingen, Germany). All siRNAs (Stealth RNAi) were from Invitrogen. siScrambled (siScr) was used as a negative control. Plasmid overexpression was achieved with the neon electroporation system (Invitrogen). The plasmids pFlot-1-GFP-N1 and pFlot-2-GFP-N1 have been described earlier [30 (link)]. Control plasmid mCherry-N1 was from Clontech. Two siRNAs and shRNAs were used to exclude that unspecific effects of an individual approach mediated the effects observed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!