Buffered formalin

Both wild-type (Cers1 + /+) and Cers1 knockout (Cers1−/−) C57BL/N6 mice were obtained from VITALSTAR (Beijing, China). sgRNA for Cers1 knockout was: Cers1-gRNA1: atctgcgcataactcggcat ggg; Cers1-gRNA2: gggtggacagcgttgcgc tgg. The animals were housed in specific pathogen-free units at 24 ± 2 °C with 40%–60% humidity in a 14-hour light/10-hour dark cycle with freely accessible food at Sichuan University Animal Center (Chengdu, China). Six- to 8-week-old female mice (Cers1 + /+ C57BL/N6 mice, n = 25 and Cers1−/− C57BL/N6 mice, n = 25) were used for the experiments. A stock solution of 4NQO (Sigma, United States) was prepared at 5 mg·mL⁻¹ (in propylene glycol). Two milliliters of stock solution was added to 100 ml of double distilled water to obtain a working concentration of 100 µg·mL⁻¹. The mice were treated with 4NQO for 16 weeks and then observed for another 8 weeks. At the end of the experimental period, mice were sacrificed. Tongues were collected and then longitudinally bisected. The left half of the tongue was immediately fixed in 10% buffered formalin (Solarbio, China). The right half of the tongue was immediately put into RNAstore (Tiangen, China) and stored at −80 °C for RT-PCR. All animal experiments were approved by the Subcommittee on Research and Animal Care of Sichuan University (WCHSIRB-D-2017-227).