Gene specific primer sets

Total RNA was isolated from cells or 1 mg of mice tissues using RNeasy Mini Kit (Qiagen). Complementary DNA (cDNA) synthesis was performed using reverse transcriptase (TOYOBO), followed by qPCR using gene‐specific primer sets (Bioneer) and QuantiTect SYBR Green PCR Kit (TOYOBO) according to the manufacturer's protocol on a Rotor‐Gene Q (Qiagen). The sequences of the primers used in qPCR are listed in Appendix Table S5.

Total RNA was extracted from cells using an RNeasy RNA extraction Mini‐Kit (Qiagen). cDNA was synthesized using an Enzynomix kit (Enzynomix), and quantitative PCR was performed using gene‐specific primer sets (Bioneer) and SYBR Green PCR Master Mix (Roche). Real‐time PCR was performed using a QuantStudio™ 3 (ABI), according to the manufacturer’s instructions. Data were normalized to the expression of β‐actin. Relative expression was calculated using the delta–delta Ct method. The sequences of the primers were as follows: mCD86 (Forward: gcacgtctaagcaaggtcac; Reverse: catatgccacacaccatccg), miNOS (Forward: ccccgctactactccatcag; Reverse: ccactgacacttcgcacaaa), mCD163 (Forward: tgtgaccatgctgaggatgt; Reverse: ctcgaccaatggcactgatg), mArg1 (Forward: ctgagctttgatgtcgacgg; Reverse: tcctctgctgtcttcccaag), mβ‐Actin (Forward: aagtgtgacgttgacatc; Reverse: gatccacatctgctggaagg).