The largest database of trusted experimental protocols

Sybr green pro taq hs premixed qpcr kit

Manufactured by Accurate Biology
Sourced in China

SYBR Green Pro Taq HS premixed qPCR kit is a reagent solution for quantitative real-time PCR (qPCR) analysis. It contains a high-sensitivity Taq DNA polymerase, SYBR Green I dye, and necessary PCR components pre-mixed for convenient setup and consistent results.

Automatically generated - may contain errors

16 protocols using sybr green pro taq hs premixed qpcr kit

1

Quantitative PCR and Western Blot Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The main instruments and equipment used in this pilot study included a Mastercycler X50 PCR instrument (Eppendorf, Framingham, MA, USA), LightCycler 96 real-time quantitative PCR instrument (Roche, Basel, Switzerland), DP71 microscope (Olympus Corporation, Tokyo, Japan), thermostatic incubator (Panasonic, Osaka, Japan) and an Amersham Imager 600 multifunctional imager (GE HealthCare, Chicago, IL, USA). The primary reagents used in this experiment included TransZol, RIPA lysis solution (TransGen Biotechnology Co., Ltd., Beijing, China), Taq enzyme (TaKaRa, Dalian, China) and goat anti-rabbit IgG-HRP, SP kit (Bioss, Beijing, China); reagents involved in WB experiments included (Solarbio Biotechnology Co., Ltd., Beijing, China), reverse transcription and SYBR® Green Pro Taq HS premixed qPCR kit (Accurate Biology; Changsha, China). FAF1 rabbit anti-B. grunniens polyclonal antibody was prepared and preserved by Gansu Provincial Cattle and Sheep Embryo Engineering Center (Lanzhou, China).
+ Open protocol
+ Expand
2

Quantification of RAPSYN Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
K562, KU812 and MEG-01 cells were inoculated into 6-well plates at a density of 1 × 10^6 cells per mL. Cells were incubated with OA2-siNC or OA2-siRAPSYN at a dose of 1 μg/mL siRNA in a humid atmosphere of 5% CO2 at 37 ℃ for 48 h. According to the manufacturer’s instructions, total RNA was extracted using TRIzol® reagents (Invitrogen, CA, USA), and the RNA was reverse-transcribed to cDNA using Evo M-MLV reverse transcription premix kit (Accurate Biology, Nanjing). Then, SYBR Green Pro Taq HS premixed qPCR kit (Accurate Biology, Nanjing) was used to detect the transcriptional levels of target genes in each group. A two-step RT-PCR was performed on a Biosystems StepOnePlus real-time fluorescence quantitative PCR apparatus. Sample analysis was conducted in triplicate. The level of target gene in a given sample was normalized to the corresponding level of GAPDH. The relative transcription of target gene was calculated by 2-∆∆Ct method.
The primers used in qRT-PCR for RAPSYN and GAPDH were as follows:

5’-GTACGACTCCGCCATGAGCA-3’ (RAPSYN Forward primer);

5’-TGGCATCCAGAGCCTTGTCC-3’ (RAPSYN Reverse primer);

5’-CTCTGATTTGGTCGTATTGGG-3’ (GAPDH Forward primer);

5’-TGGAAGATGGTGATGGGATT-3’ (GAPDH Reverse primer).

+ Open protocol
+ Expand
3

Quantification of Gene Expression by Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA of each treatment group was extracted using AG RNAex Pro RNA Extraction Reagent (AG21101, Accurate Biotechnology, China) and reverse transcribed into cDNA. The real‐time PCR experiment was performed using SYBR® Green Pro Taq HS premixed qPCR Kit (AG11701, Accurate Biotechnology, China) with the primers provided in Table S1. GAPDH was used as an internal reference and the 2ΔΔCt method was used to calculate the gene expression levels.
+ Open protocol
+ Expand
4

Quantifying OIP5-AS1, ATG12, and miR-30e-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using TRIzol reagent (Accurate Biology) following the manufacturer's protocol and reversed transcribed into cDNA using the Evo M-MLV RT Kit (Accurate Biology). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using the SYBR® Green Pro Taq HS premixed qPCR kit (Accurate Biology). The primers involved were OIP5-AS1 forward (AGGAACTAACCGAACATTCT), OIP5-AS1 reverse (GCCTGTTTGGTGGTCTC). ATG12 forward (TTTGCTAAAGGCTGTGGG), ATG12 reverse (AAGGAGCAAAGGACTGAT), hsa-miR-30e-5p reverse transcription primer (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTCCA), hsa-miR-30e-5p forward (GCGCGTGTAAACATCCTTGAC), hsa-miR-30e-5p reverse (AGTGCAGGGTCCGAGGTATT), and U6 forward (CTCGCTTCGGCAGCACA), U6 reverse (AACGCTTCACGAATTTGCGT). ACTB was used as an endogenous control for normalization, and the 2−ΔΔCt method was used to evaluate the comparative quantification.
+ Open protocol
+ Expand
5

Quantitative Analysis of Pigmented Potato

Check if the same lab product or an alternative is used in the 5 most similar protocols
Used Trizol kit (TIANGEN BIOTECH CO., LTD.) to extract total RNA from tubers of pigmented potatoes in different growth periods. Use Evo M-MLV reverse transcription premixed kit (including gDNA removal reagent for qPCR) Ver 2 (Accurate Biology), used SYBR ® Green Pro Taq HS premixed qPCR kit (including ROX) (Accurate Biology) conducts real-time fluorescent quantitative PCR reaction. StGAPDH was the reference gene. The cDNA obtained by reverse transcription was diluted 10 times and used as a template. The primers of all genes (Table 1) were designed with SnapGene 4.3.6 software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. All primers were diluted 10 times before being used. Reaction procedure: 95 °C 2 min, 95 °C 15 sec, 60 °C 30 sec, 40 cycles, Melt Curve Stage, 2- ΔΔ Ct method (Livak and Schmittgen, 2001 (link)).
+ Open protocol
+ Expand
6

Quantitative Analysis of ITGAL Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the instructions, the total RNA of tissue samples was extracted by using MolPure® Cell/Tissue Total RNA Kit (YEASEN CAT#19221ES50). The cDNA of samples was synthesized from 2 µg RNA via Evo M‐MLV reverse transcription master mix (Accurate Biology, CAT#AG11706). The qRT-PCR was performed using a SYBR Green Pro Taq HS premixed qPCR kit (Accurate Biology, CAT# AG11701). The ITGAL primer sequence is as follows: forward 5′-CTG​CTT​TGC​CAG​CCT​CTC​TGT-3′ and reverse 5′-GCT​CAC​AGG​TAT​CTG​GCT​ATG​G-3′. GAPDH: forward 5′-CGG​AGT​CAA​CGG​ATT​TGG​TCG​T-3′ and reverse 5′-TCT​CAG​CCT​TGA​CGG​TGC​CA-3′. The 2−ΔΔCT calculation method was used to determine the relative target gene level.
+ Open protocol
+ Expand
7

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cultured cells using TRIzol reagent (Accurate Biology). cDNA was synthesized with Evo M-MLV reverse transcription master mix (Accurate Biology) from 500 ng of RNA from each sample. A SYBR@ Green Pro Taq HS premixed qPCR kit (Accurate Biology) was used for qPCR. Data are shown as ‘2-ΔΔCT’. The primers are listed in Supplementary Table 1.
+ Open protocol
+ Expand
8

Isolation and Quantification of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were isolated by using TRIzol Reagent (CW0580S, CWBIO) according to the manufacturer’s instructions. Then, cDNAs were synthesized with the Reverse Transcriptase kit (E047-01B, Novoprotein) as we previously reported (12 (link)). After that, qRT-PCR analysis was conducted by using the SYBR Green Pro Taq HS premixed qPCR kit (AG11701-S, Accurate Biotechnology) and the ABI PRISM 7900 (Applied Biosystems). In details, an initial denaturation step of 95°C for 30s, followed by 40 cycles of 95°C for 5s and 60°C for 30s. The results were calculated by using 2-ΔΔCt method. The primer sequences were shown in Supplementary Table S1. GAPDH was used as internal reference.
+ Open protocol
+ Expand
9

Quantitative Analysis of mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the cell lines using AG RNAex Pro RNA Kit (AG21101, Accurate Biotechnology, Changsha, Hunan, China). Subsequently, cDNA was synthesized and reverse transcribed using the Evo M-MLV RT Kit with gDNA Clean for RT-qPCR (AG11705, Accurate Biotechnology, Changsha, Hunan, China). Real-time polymerase chain reaction (RT-PCR) was performed with the SYBR Green Pro Taq HS premixed qPCR kit (AG11701, Accurate Biotechnology, Changsha, Hunan, China), and expression levels were calculated using the 2^(−ΔΔCt) method. mRNA expression was normalized to the expression level of β-actin mRNA. All primers were provided by Accurate Biotechnology Co., Ltd. (Changsha, Hunan, China), and the detailed primer sequences are shown in Supplementary Table S1. All data are presented as the mean ± SD of three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
+ Open protocol
+ Expand
10

Poplar Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative RT-PCR was employed to analyze the expression levels of nitrate reductase (NR), nitrite reductase (NiR), asparagine synthetase (AS), asparaginase (ASPG), glutamine synthase (GS), glutamate synthase (GOGAT), cell wall apoplastic invertase (CWINV1), and vacuolar invertase (VI2) genes in the leaves, stem, and roots of poplar. Total RNA was extracted by using RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (TIANGEN, Beijing, China). The purity and concentration of the extracted RNA were checked by the Microvolume Spectrophotometer (Colibri LB 915, Bad Wildbad, Germany) and then verified through agarose gel electrophoresis. Reverse transcription kit (PrimeScriptTM RT reagent Kit with gDNA Eraser, Takara, Japan) was used to synthesize the first strand of cDNA. Gene-specific primers (Supplement Table S1) were designed by Primer3 (http://primer3.ut.ee/, accessed on 21 February 2022). Quantification of gene amplification was performed on the real-time fluorescent quantitative PCR instrument (Applied Biosystems StepOneTM, Beijing, China) with the fluorescent agent AG SYBR Green Pro Taq HS premixed qPCR kit (Accurate Biology, Changsha, China).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!