The largest database of trusted experimental protocols

Ez magna chip a g assay kit

Manufactured by Merck Group
Sourced in United States

The EZ‐Magna ChIP A/G Assay Kit is a laboratory equipment product designed for chromatin immunoprecipitation (ChIP) experiments. It provides a simple and efficient method for isolating and purifying DNA-protein complexes from cells or tissues. The kit includes all the necessary reagents and materials to perform ChIP assays.

Automatically generated - may contain errors

8 protocols using ez magna chip a g assay kit

1

Chromatin Immunoprecipitation of ATF4 Transcription Factor

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed using the EZ‐Magna ChIP A/G Assay Kit (Millipore, Billerica, Massachusetts) according to the manufacturer's instructions. Briefly, cells were crosslinked with 1% formaldehyde at room temperature for 10 minutes. Then, the cells were collected and lysed with nuclear lysis buffer containing a protease inhibitor cocktail to isolate the nuclei. Sonication was performed to shear the chromatin and generate 200 to 1000 bp DNA fragments. The sheared chromatin was immunoprecipitated with primary antibodies against ATF4 (11815; CST), normal rabbit IgG (2729; CST), and anti‐RNA polymerase II. After the protein‐DNA crosslinks were reversed, the precipitated DNA was purified and subsequently analyzed using qRT‐PCR. Data were normalized to the input control. The ChIP‐qPCR primers for the Smurf2 promoter were forward, 5′‐CCCCCACGCTATTGTCCTTA‐3′, and reverse, 5′‐CCAGGAACCGCATGGTTTTT‐3′.
+ Open protocol
+ Expand
2

ChIP Assay Protocol for p65 and H3K9ac

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed using the EZ-Magna ChIP A/G assay kit (Millipore, 17-10086) according to the manufacturer’s instructions. Briefly, cells were crosslinked with 1% formaldehyde at room temperature for 10 min, and the collected cells were lysed to isolate the nuclei with nuclear lysis buffer containing a protease inhibitor cocktail. Then, sonication was used to shear the chromatin and generate 200–1,000-bp DNA fragments. Finally, the sheared chromatin was immunoprecipitated with primary antibodies against p65 (Cell Signaling Technology, 8242 S) and H3K9ac (Abcam, ab32129), normal rabbit IgG and anti-RNA polymerase II antibody (provided in the kit). After protein‒DNA crosslinking had been reversed, the precipitated DNA was purified and subsequently analyzed by qRT‒PCR. Data were normalized to the input control. The primers used for ChIP‒qPCR are listed in Supporting Information Table S4.
+ Open protocol
+ Expand
3

ChIP Assay for Transcription Factor Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation (ChIP) assays were performed using the EZ-Magna ChIP A/G Assay kit (Millipore) according to the manufacturer’s instructions. Briefly, cells were crosslinked with 1% formaldehyde at 25 ± 5 °C room temperature for 10 min. Cells were then collected and lysed to isolate the nuclei with nuclear lysis buffer containing protease inhibitor cocktail (provided in the kit). Sonication was performed to shear chromatin, generating 200–1000 bp DNA fragments. The sheared chromatin was immunoprecipitated with primary antibodies, normal IgG, and anti-RNA polymerase II antibody (provided in the kit). After the protein-DNA crosslinking was reversed, the relative binding of EBF3 to the LINC01119 promoter was analyzed using PCR with an Applied Biosystems Simpliamp instrument (ThermoFisher, USA). Agarose gel electrophoresis was used to detect DNA–protein binding. Data were normalized to the input control.
+ Open protocol
+ Expand
4

Investigating STAT3 Activation via ChIP-seq

Check if the same lab product or an alternative is used in the 5 most similar protocols
The chromatin immunoprecipitation (ChIP) assay was done on HT22 cells cultured in IL-6 (40ng/mL) to promote the STAT3 activation by SeqHealth (Wuhan, China). Following the above-mentioned processes, the cell protein-DNA complexes were cross-linked using 1% formalin in PBS on a rocking device at room temperature for 15min. The formaldehyde was quenched by adding 125mM glycine and rocked for 5min at room temperature. Afterward, the cells were collected and treated with lysis buffer in 500μL per 5×106 cells on ice for 10min. The chromatin was sheared to an average length of about 1kb using sonication. After ultracentrifugation (10min) with a refrigerator at 12,000×g, we collected the supernatants and performed ChIP using the EZ-Magna ChIP A/G Assay kit (Millipore, 17-10086, United States). The chromatin mixture was immunoprecipitated with anti-phospho-STAT3 (Tyr705) antibody (1:100, Cell Signaling Technology, 9,145, United States). The DNA was purified and sequenced with ChIP-seq.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation Assay for Histone H1 and HMGB1

Check if the same lab product or an alternative is used in the 5 most similar protocols
The assay was performed using EZ-Magna ChIP A/G assay kit (Millipore) according to the manufacturer's instructions with minor modifications. Briefly, HeLa cells were treated with 1 μg/ml staurosporine for 10 h, with 32 mM H2O2 for 4 h, or heated at 65 °C for 1 h and incubated for 3 h. The conditioned media were fixed with 1% formaldehyde for 10 min, quenched with 1X glycine for 5 min and concentrated. The concentrated media were incubated overnight with goat polyclonal anti-histone H1 antibody (Santa Cruz Biotechnology), goat polyclonal anti-HMGB1 antibody (Santa Cruz Biotechnology) or normal goat serum. The antibody–protein–DNA complexes were captured by incubation with EZ-Magna ChIP A/G. Genomic DNA segments from complexes were eluted, digested with proteinase K digestion and purified using spin columns. Aliquots of the DNA were used as a template for PCR amplification using 35 cycles of 55 °C annealing temperature. The GAPDH primers for PCR amplification were 5′-CCCCTTCATTGACCTCAACTAC-3′ and 5′-GAGTCCTTCCACGATACCAAAG-3′.
+ Open protocol
+ Expand
6

Chromatin Immunoprecipitation for Epigenetic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation (ChIP) assays were performed using the EZ‐Magna ChIP A/G Assay kit (Millipore) according to the manufacturer's instructions. Briefly, cells were crosslinked with 1% formaldehyde at room temperature for 10 minutes. Then, cells were collected and lysed to isolate the nuclei with nuclear lysis buffer containing protease inhibitor cocktail (provided by the kit). Sonication was performed to shear chromatin, generating 200–1,000‐bp DNA fragments. The sheared chromatin was immunoprecipitated with primary antibodies, such as hnRNPK (ab39975; Abcam), histone H3 lysine 27 acetylation (H3K27ac; ab39975; Abcam), normal mouse IgG and anti‐RNA polymerase II antibody (provided by the kit). After protein‐DNA crosslinking was reversed, the precipitated DNA was purified and subsequently analyzed by qRT‐PCR. Data were normalized to the input control. The ChIP‐qPCR primers used are listed in Supporting Information Table S4.
+ Open protocol
+ Expand
7

Chromatin Immunoprecipitation (ChIP) with Anti-hnRNP A1 Antibody

Check if the same lab product or an alternative is used in the 5 most similar protocols
The EZ‐Magna ChIP A/G Assay Kit (Millipore) was used for chromatin immunoprecipitation (ChIP) assays according to the instruction manual from the manufacturer. Cells were treated with 1% formaldehyde for chromatin crosslinking and then collected and lysed with cell membrane extraction buffer to obtain the nuclei. Chromatin was then sheared by sonication into 200‐1000 bp DNA fragments and immunoprecipitated with normal rabbit IgG control or an anti‐hnRNP A1 antibody (Abcam). The precipitated DNA was then purified and went through PCR amplification for detection. ChIP primers designed for qPCR are listed in Table S6.
+ Open protocol
+ Expand
8

ChIP Assay for c-Myc and miR-21

Check if the same lab product or an alternative is used in the 5 most similar protocols
With the EZ-Magna ChIP A/G Assay Kit (Millipore, US), chromatin immunoprecipitation assays were performed following the manufacturer's protocol. The antibody against c-Myc was purchased from Abcam (US). Primers flanking the c-Myc binding sites on the miR-21 promoter were used for qPCR, and the sequences were as follows: forward, 5'-CATTGCACACCCTCTGGGGAAATT-3, and reverse 5'-CAAGACTTCATTCTAAATACACAG-3'.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!