Total RNA from S. pseudintermedius ATCC 49051 was isolated as described above, and cDNA was synthesized using the M-MLV cDNA synthesis kit (Enzynomics, Daejeon, Korea). qPCR was performed using an ABI Step One Plus Real-Time System (Applied Biosystems, Waltham, MA, USA). TOPreal™ q-PCR 2X PreMix (SYBR Green with high ROX; Enzynomics) was used. Total RNA was also isolated from the dissected left ears of mice in in vivo experiments. The primers used to validate qPCR and the expression of cytokine genes are listed in Supplementary Table S1
Abi step one plus real time system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI Step One Plus Real-Time System is a laboratory instrument designed for real-time quantitative polymerase chain reaction (qPCR) analysis. The system offers precise temperature control and data collection capabilities for accurate gene expression quantification and DNA/RNA detection.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (4 mentions)
Topreal qpcr 2x premix sybr green with high rox, by Enzynomics (3 mentions)
M mlv cdna synthesis kit, by Enzynomics (3 mentions)
Steponeplus detection system, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Improm 2 rt, by Promega (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Primer express v3, by Thermo Fisher Scientific (1 mentions)
Recombinant dnase 1, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Cfx96tm real time system, by Bio-Rad (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
Abi steponeplus, by Thermo Fisher Scientific (1 mentions)
Agilent 2100 bioanalyzer, by Thermo Fisher Scientific (1 mentions)
Hiseq technique, by Illumina (1 mentions)
Trizol, by Takara Bio (1 mentions)
Hiseq 2500 platform, by Illumina (1 mentions)
Agilent bioanalyzer 2100 system, by Agilent Technologies (1 mentions)
Primescripttm rt reagent kit, by Takara Bio (1 mentions)
14 protocols using abi step one plus real time system
1
Validation of Cytokine Gene Expression in S. pseudintermedius
2
Quantitative Analysis of NKG2D and MICA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained using the Qiagen RNeasy kit (Qiagen, CA). Isolated RNA samples were dissolved in RNase-free water, and RNA quantity was measured using NanoDrop (Thermo Fisher Scientific). cDNA was synthesised from 10 μg of total RNA at a volume of 100 μl using ImProm RT-II™ (Promega) according to the manufacturer’s instructions. cDNA samples were diluted with sterile deionised water to a total volume of 100 μl, and 2 μl was added to a PCR reaction. Quantitative RT-PCR (qRT-PCR) was performed on an ABI step one plus real-time system (Applied Biosystems, USA). We analyzed the relative expression levels of NKG2D and MIC A genes using the primers described above
[31 (link)].
[31 (link)].
3
Quantitative RT-PCR Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR analysis was performed on an ABI step one plus real-time system (Applied Biosystems). Total cellular RNA was isolated from each sample by using a Qiagen RNeasy Kit (Qiagen, Valencia, CA). One microgram of total RNA from each sample was subjected to cDNA synthesis using the Superscript III reverse transcriptase (Invitrogen). cDNAs were amplified by PCR with primers as follows: Perforin (sense, 5′-TCCTATGGCACGCACTT TATCAC-3′; antisense, 5′-TCCACGTTCAGGCAGTCTCCTAC-3′); Granzyme B (sense, 5′-GCTGCTAAAGCTGAAGAGTAAGG-3′; antisense, 5′-GCGTGTTTGAGTATTTGCCC A TT-3′); TGF-β (sense, 5'-TGGAAACCCACAACGAAATCT-3′; antisense, 5'-GCTGAGGT ATCGCCAGGAAT-3′); β-actin (sense, 5′-TTTCCAGCCTTCCTT CTTGGGTAT-3′; antisense, 5′-TGTTGG CATAGAGGTCTTTACGG-3′). The mRNA levels of the genes of interest were expressed as the ratio of each gene of interest to β-actin for each sample. SYBR Green quantitative PCR amplifications was performed in the Step one plus Detection System (Applied Biosystems). The comparative Ct (ΔΔCt) method was used to determine the expression fold change [3 (link)].
4
Quantitative Analysis of miR-200c and ZEB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative-PCR analysis was performed on an ABI step one plus real-time system (Applied Biosystems). The comparative Ct (ΔΔCt) method was used to determine the expression fold change [12 (link)]. Total cellular RNA was isolated from each sample by using a Qiagen RNeasy Kit (Qiagen, Valencia, CA). One microgram of total RNA from each sample was subjected to cDNA synthesis using the Superscript III reverse transcriptase (Invitrogen). cDNAs were amplified by PCR with primers as follows: miR-200c (sense, 5′-GAAGATCTGGAGCAGG AGATCTGCCGCTTC-3; reverse, GGAATTCAGAGCCACCCTTAACTCGG); ZEB1(sense, 5′-TGAGCACACAGGTAAGAGGCC-3′; reverse, 5′-GGCTTTTCCCCAGAGTGCA-3′); β-actin (sense, 5′-GCCCTGAGGCTCTTTTCCA −3′; reverse, 5′-TTACGGATGTCAACGTC A-3′); U6 (sense, 5′-CTCGCTTCGGCAGCACATAGG-3′; reverse, 5′-AACGCTTCACGAA TTTGCG TAGGAG-3′); URP Universal Reverse Primer, 5′-CCGGCAGGGTCCGAGGT-3′.
5
Quantitative RT-PCR Analysis of EBI3 and p35 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR analysis was carried out on an ABI step one plus real-time system (Applied Biosystems). We used a Qiagen RNeasy Kit (Qiagen, Valencia, CA) to isolate total cellular RNA from each sample. One microgram of total RNA from each sample was subjected to cDNA synthesis using the Superscript III reverse transcriptase (Invitrogen). cDNAs were amplified by PCR with primers as following: EBI3 (sense, 5′-CATTGCCACTTACAGGCTCG-3′; antisense, 5′-GGATGT ACGATTTACAGTGACGT-3′); p35 (sense, 5′-CAATCACGCTACCTCCTCTTT T-3′; antisense, 5′-CTTTGTAATAAGGACGTGACGAC-3′); β-actin (sense, 5′-GGCTGT ATTCCCCTCCATCG-3′; antisense, 5′-TGTACCGTAACAATGGTTGACC-3′). The ratio of each interest gene to β-actin for each sample was noted as mRNA expressive level of the interest genes. SYBR green quantitative PCR amplifications were performed in the Step one plus Detection System (Applied Biosystems). The comparative Ct (ΔΔCt) method was adopted to definite the expression fold change [18 (link),19 (link)]. All the primers were synthesized by Gene and Technology of China in Shanghai.
6
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1 μg) was synthesized with an M-MLV cDNA Synthesis kit (Enzynomics, Daejeon, South Korea) to generate complementary DNA (cDNA). For RT-qPCR, Primer Express v.3.0 (Applied Biosystems) was used to design primer sequences. RT-qPCR was performed using the ABI Step One Plus Real-Time System (Applied Biosystems) and TOPreal q-PCR 2X PreMIX (SYBR Green with high ROX, Enzynomics). The relative transcript levels were normalized to the level of 16S rRNA, and relative expression was determined by the ΔΔCt method. The primers used in RT-qPCR are listed in Supplementary Table 3. Each RT-qPCR experiment was performed at least three times.
7
Gene Expression Profiling in Metabolic Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression of acetyl-CoA carboxylase 1 (ACC1), AMPKα1 and AMPKα2 in hepatic tissues, and mRNA expression of leptin, uncoupling protein 2 (UCP2), adiponectin, CCAAT/enhancer-binding protein (C/EBP)α, C/EBPβ and sterol-regulatory-element-binding protein 1c (SREBP1c) in periovarian adipose tissue were determined using RT-qPCR (46 (link)). Briefly, RNA from adipose tissues was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The RNA quality and quality were assessed using the CFX96TM Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The isolated RNA samples were treated with recombinant DNase I (Ambion; Thermo Fisher Scientific, Inc.) and reverse-transcribed using a high-capacity cDNA RT kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). The analyses were performed using the ABI Step One Plus Real-Time System (Applied Biosystems; Thermo Fisher Scientific, Inc.) (47 ), with mRNA expression calculated relative to the vehicle control. The following thermal conditions were applied: 94°C for 10 min; 39 cycles of 94°C for 15 sec and 57°C for 20 sec; and 72°C for 30 sec. The data were normalized to GAPDH mRNA expression using the comparative threshold cycle method (48 (link)). The oligonucleotide primer sequences used for PCR are listed in Table I .
8
Quantitative RT-PCR Analysis of A. baumannii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from A. baumannii strains was isolated as described earlier, and cDNA was synthesized using the M-MLV cDNA Synthesis kit (Enzynomics). Real-time PCR amplification of cDNA was performed using the ABI Step One Plus Real-Time System (Applied Biosystems), and TOPreal™ q-PCR 2X PreMIX (SYBR Green with high ROX, Enzynomics) was used. The internal forward and reverse primers used in this study for each gene are listed in Supplementary Table S4
9
qRT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction and synthesis of cDNA were performed according to Dehbashi et al. study37 (link). PCR reactions were performed in 96-well microplates (ABI-Step One-Plus) using the ABI-Step One-Plus Real-time System, ABI, USA. qRT-PCR was carried out using 4 μl of 2 × FIREPol Master Mix (Solis BioDyne, Tartu, Estonia), 0.5 μl (10 pM) forward and reverse primers were 2 μl template cDNA, and 13 μl RNase free water to a final volume of 20 μl. The PCR protocol was designed for 40 cycles, and a melting-curve analysis (65–95 °C, fluorescence read every 0.3 °C) was performed to check the amplification specificity. For differential gene expression study, relative quantification was achieved using the CT comparative method (Fold of Expression = 2−ΔΔCT)45 (link).
10
qRT-PCR Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and cDNA synthesis were performed by GeneAll mini kit (GeneAll Biotechnology, Korea) [42 (link)]. Relative quantification was carried out using the Cycle Threshold (CT) comparative method. qRT-PCR reactions were performed in 96-well microplates (ABI-Step One-Plus) using the ABI-Step One-Plus Real-time System, ABI, USA. Components used for each reaction in q-PCR were 1 μl aliquot of the first-strand cDNA in a final volume of 20 μl; containing 10 pM of specific primers (forward and reverse) was used. PCR was carried out using 4 μl 2x FIREPol Master Mix RTL MgCl2 Master Mix (Solis BioDyne, Tartu, Estonia), primer forward and reverse both were 0.5 μl, template cDNA 2 μl, and RNase free water 13 μl to final volume 20 μl. The PCR protocol was designed for 40 cycles, and a melting-curve analysis (65 °C to 95 °C, fluorescence read every 0.3 °C) was performed to check the specificity of the amplification. Relative quantification was achieved using the CT comparative method [43 (link)]. For quality control, S. aureus ATCC 25923 and S. aureus ATCC 43300 were used in the study.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!