Rabbit anti homer1

Following fixation, sections were rinsed in 175 mM PB for 4 hr, then a buffered glycine solution (50 mM glycine in 175 mM PB) for 16 hr, and then rinsed for 6 hr in 175 mM PB. Regions of 300-μm-thick coronal sections were then trimmed down to volumes of approximately 2 × 2 × 0.3 mm³ with a scalpel. For labeling of Homer in postsynaptic terminals (Figure 4a, b), sections were incubated in rabbit anti-Homer 1 (Synaptic Systems) for 72 hr, rinsed in 175 mM PB for 8 hr, and then incubated in Alexa Fluor-594 donkey anti-rabbit IgG F(ab’)₂ fragment (Jackson ImmunoResearch) for 48 hr. For labeling of synaptophysin in presynaptic terminals (Figure 4c), sections were first incubated in Alexa Fluor-488 conjugated rabbit anti-synaptophysin (Abcam) for 72 hr, rinsed in 175 mM PB for 24 hr, and then incubated in Alexa Fluor-594 conjugated rabbit anti-synaptophysin (Abcam) plus 0.3% Triton for 48 hr.

Rabbit anti-Cleaved Caspase-3 (Cell Signaling Technology #9661, 1:2000), Mouse anti-Calbindin (Sigma #C9848, 1:2000), Rat anti-HA 3F10 (Sigma #12158167001, 1:500), Mouse anti-Bassoon (Abcam #ab82958, 1:500), Rabbit anti-Homer1 (Synaptic Systems #160002, 1:500), Chick anti-Tyrosine Hydroxylase (Abcam #ab76442, 1:1000), and Mouse anti-NeuN (Abcam #ab104224, 1:1000).

Rat primary cortical cultures were established in black-walled, glass bottom 96-well plates (μClear, Greiner Bio-One) with the same cell density and culture conditions as described for MEA experiments. Following a 4-day treatment with extract from AD patient, ALB01, or vehicle (media alone), the cultures were washed with ice cold PBS and fixed with 4% paraformaldehyde in PBS. Following fixation, the cells were permeabilized with 1% Triton X-100 in donkey serum (Jackson ImmunoResearch). The cells were probed with primary antibodies for tau (1:200, A0024, Dako), followed by anti-rabbit Cy3 secondary antibodies (Jackson ImmunoResearch) and 1 μg/mL DAPI (Thermo Fisher). Mouse anti-Vglut2 (Abcam, 1:1000) and rabbit anti-HOMER1 (Synaptic Systems, 1:1000) were used to quantify VGLUT2 and HOMER1 in aged (Day 21) iNs transduced with the lentivirus (Lenti-eGFP or Lenti-GM2A) at MOI = 5 on Day 5 or treated with TBS or AD brain extract (ALB01) from Day 17. Analysis was performed using Fiji (National Institutes of Health) by counting the number of puncta along each neuritic segment (~ 10 um), and 15 images were counted in each condition. Co-localization of puncta was defined by overlap within a circular area covering 0.52 um². Images were acquired at 40X using an LSM710 confocal microscope (Zeiss).

Protein extracts were resolved by SDS-PAGE, transferred onto nitrocellulose membrane (BioTraceNT, PALL), immunoblotted with the following primary antibodies: mouse anti-FMRP^{18 (link)} 1 µg/mL (DSHB, Clone 2F5-1); Rabbit anti-GluA1 C-terminal 1/1000 (Merk-Millipore #AB1504); Rabbit anti-GluA2 C-terminal 1/2000 (Synaptic System #182103); Rabbit anti-Homer1 1/1000 (Synaptic Systems #160003); Mouse anti-PSD95 1/10000 (NeuroMab #75-028 clone K28/43); Goat anti-GluN1 1/500 (Santa-Cruz #sc-1467); Mouse anti-Synapsin1a/b 1/500 (Santa-Cruz #sc-376623); Rabbit anti-GAD65/67 1/500 (Merk-Millipore #ABN904); Rabbit anti-CaMKII 1/500 (Santa-Cruz #sc-9035); Rabbit anti-Arc 1/1000 (Synaptic Systems #156003); Mouse anti-Gephyrin 1/1000 (Synaptic System #147111); Rabbit anti-vGluT1 1/5000 (Synaptic System #135303). Standard loading controls were included using a rabbit anti-GAPDH antibody 1/25000 (Sigma #G9545) or a rabbit anti-β3 Tubulin 1/25000 (Synaptic Systems #302302) as indicated. Proteins were revealed using the appropriate HRP-conjugated secondary antibodies (GE healthcare #NA931V and #NA934V). Proteins were then identified using Immobilon Western (Millipore) chemiluminescent solution and images acquired on a Fusion FX7 system (Vilber Lourmat). Full-size blots for cropped gels are shown in the Source data file.

The following primary antibodies were used in this study: mouse anti-α-tubulin (clone DM1A, T6199; Sigma-Aldrich), mouse anti-Bassoon (141021; Synaptic Systems), rabbit anti-Homer 1 (160021; Synaptic Systems), goat anti-MAP1B (N19; Santa Cruz Biotechnology), rabbit anti-MAP1B-LC1 (H130; Santa Cruz Biotechnology), rabbit anti-MAP2 (AB5622, Millipore), rabbit anti-PSD-95 (APZ-009, Alomone), rabbit anti-SNAP-25 (111002, Synaptic Systems), mouse anti-Synaptophysin I (101011; Synaptic Systems), mouse anti-Synaptotagmin I (105011; Synaptic Systems), and mouse anti-tau-1 (MAB3420, Millipore). Secondary antibodies for immunoblots were HRP-conjugated anti-mouse and anti-rabbit IgG (Jackson Laboratories), and HRP-conjugated anti-goat IgG (Santa Cruz Biotechnology). Secondary antibodies for immunocytochemistry were anti-mouse, anti-rabbit and anti-goat conjugated to Alexa-Fluor 488, 543 or 633 (Thermo Fischer).

For in situ hybridization, frozen brains were coronally sectioned in a cryostat microtome at 18 µm and kept at −80°C. In situ hybridization using a ³⁵S UTP-labeled ribonucleotide probe for Homer1b/c (Forward primer: AACACTGGGAGGCTGAGCTA; Reverse primer: TACTGCGGAAAGCCTCTTGT) was performed as described previously [34] (link). For fluorescence immunohistochemistry, serial coronal sections were cut at 30 µm thickness. Double-labeling immunofluorescence (rabbit anti-Homer1, 1∶1000, Synaptic Systems; goat anti-GFP, 1∶500, Abcam) was performed on free-floating sections (n = 3 per mouse) as described previously [35] (link).

The brain extracts and cell lysates were separated by 4–12% Bis-Tris gels (Thermo Fisher), followed by transfer to nitrocellulose membrane using Criterion blotter system (Bio-Rad). Nitrocellulose membranes were incubated with Intercept blocking buffer (LI-COR) for 1 hr. at room temperature, followed by overnight incubation with rabbit anti-GM2A antibody (1:1000, Proteintech), mouse anti-GAPDH (1:10,000, Proteintech), rabbit anti-HOMER1 (Synaptic Systems, 1:1000), or mouse anti-Vglut2 (Abcam, 1:1000). Membranes were washed 3 times with TBST and incubated with fluorescent dye-conjugated secondary antibodies (anti-mouse or anti-rabbit, 1:10,000, LI-COR) for 1 hr. at room temperature. Membranes were washed 3 times with TBST and then 2 times with TBS, followed by scanning using an Odyssey Infrared Imaging System (LI-COR).