Plasmid purification, PCR product purification, and gel extractions were performed using the following kits: the QIAprep, Spin Miniprep Kit, the Qiagen Plasmid Midi Kit, the QIAquick PCR Purification Kit (Qiagen). Ligation reactions, E. coli transformations, and other routine DNA manipulations were carried out according to the methods outlined by Sambrook et al. (1989) . Restriction enzymes and T4 DNA ligase (Thermo Scientific). G. sulfurreducens genomic DNA was extracted using the MasterPure complete DNA and RNA purification kit (Epicenter).
Qiaprep
Manufactured by Qiagen
Sourced in Germany
QIAprep is a lab equipment product designed for plasmid DNA purification. It utilizes a silica membrane-based technology to efficiently isolate high-quality plasmid DNA from bacterial cultures.
Automatically generated - may contain errors
Lab products found in correlation
Unnatural oligonucleotides, by Biosearch Technologies (2 mentions)
D5sics, by WuXi AppTec (2 mentions)
Dmmo2bio, by WuXi AppTec (2 mentions)
Zr plasmid miniprep classic, by Zymo Research (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Spin miniprep kit, by Qiagen (1 mentions)
T4 dna ligase, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Masterpure complete dna and rna purification kit, by Illumina (1 mentions)
Plasmid midi kit, by Qiagen (1 mentions)
Bl21 star de3 cells, by Thermo Fisher Scientific (1 mentions)
Neb turbo cells, by New England Biolabs (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Miniprep plasmid purification kit, by Qiagen (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
S1 nuclease, by New England Biolabs (1 mentions)
Maxiprep kit, by Qiagen (1 mentions)
T4 dna polymerase, by New England Biolabs (1 mentions)
Mlui restriction enzyme, by Thermo Fisher Scientific (1 mentions)
Scriptcap cap 1 capping system, by CellScript (1 mentions)
15 protocols using qiaprep
1
Molecular Biology Techniques Compendium
2
Plasmid Assembly and Protein Expression
3
Genomic DNA and Plasmid Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of E. coli MG1655 and M. extorquens AM1 were extracted using Promega Wizard Genomic DNA Purification Kit (Madison, MI). Plasmids were extracted from E. coli using Qiagen QIAprep or MiniPrep plasmid purification kit (Valencia, CA). Experiments were performed according to manufacture protocols.
4
Expanded Genetic Alphabet Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A complete list of plasmids and the sequences of oligonucleotides used in this work can be found in Supplementary Tables 1–2 . gBlock® gene fragments and natural oligonucleotides (with standard purification and desalting) were purchased from IDT (San Diego, California, USA). Sequencing was performed by Genewiz (San Diego, California, USA). Plasmids were isolated using commercial miniprep kits (QIAprep, Qiagen or ZR Plasmid Miniprep Classic, Zymo Research). pEVOL-pAzF14 (link) was kindly provided by Peter Schultz (The Scripps Research Institute, USA).
Nucleosides of dNaM , dTPT3 , NaM , TPT3 , d5SICS and dMMO2bio were synthesized (WuXi AppTec, Shanghai, China) and triphosphorylated (TriLink BioTechnologies LLC, San Diego, USA and MyChem LLC, San Diego, USA) commercially. All unnatural oligonucleotides were synthesized by Biosearch Technologies (Petaluma, California, USA) with purification by reverse phase cartridge.
Nucleosides of d
5
Molecular Cloning and Transformation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloning was done using standard molecular biology procedures (Sambrook & Russell, 2001 ). Escherichia coli XL1Blue (Stratagene, San Diego, CA, USA) cells were transformed by electroporation (Bio-Rad Laboratories, Hercules, CA, USA). Plasmid DNA was purified with the QIAprep or Maxiprep kits (Qiagen, Valencia, CA, USA). DNA fragments were purified with the QIAquick or QIAEX II kits (Qiagen, Valencia, CA, USA). Restriction enzymes, T4 DNA polymerase, T4 DNA ligase, S1 nuclease were purchased from New England Biolabs. PCR were performed with the proofreading PfuTurbo DNA polymerase (Stratagene, San Diego, CA, USA). Oligonucleotide synthesis and DNA sequencing were carried out by Eurofins MWG Operon. The construction and maps of the plasmids (Figs. S2 –S12 ) generated during this study are provided in the supplemental material.
6
Expanded Genetic Alphabet Protocols
7
Generating Self-Replicating RNA Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The T7-VEE-OKS-iM plasmid, a gift from Steven Dowdy (Addgene plasmid # 58972 ), containing sequences encoding the non-structural proteins (nsP1 to nsP4) for self-replication, the reprogramming factors Oct4, Klf4, Sox2, and cMyc [14 (link)] and an additionally added internal ribosome entry site (IRES)-GFP was amplified in E.coli and plasmids were isolated using QIAPrep (Qiagen, Hilden, Germany). After the linearization with MluI restriction enzyme (Thermo Fisher Scientific), 10 µg template DNA was transcribed in vitro using RiboMAX large-scale production system T7 Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Afterwards, 2 U TURBO DNase was added for 15 min at 37 °C. For 5′-end capping, ScriptCap Cap1 Capping System was used followed by 3′-end polyadenylation with A-Plus Poly(A) Polymerase Tailing Kit (both from Cellscript, Madison, WI, USA) according to the manufacturer’s instructions. Following each reaction step, srRNA was purified using RNeasy Kit (Qiagen). The specific lengths of the generated DNA and srRNA products were analyzed using 1% agarose gel electrophoresis.
8
Cloning and Expression of MytiLec
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A synthetic gene encoding MytiLec was designed with flanking NdeI and BamH1 restriction sites. Codon optimisation was performed using the back-translation tool from Entelechon, and the gene was synthesised by Operon. The initial reported residue of MytiLec is threonine. This was changed to alanine so that expression of the native sequence would result in efficient removal of the N-terminal methionine, but expression with an N-terminal histidine tag was exclusively used for protein production. The initiator methionine residue is numbered zero, in accordance with the UNIPROT entry B3EWR1. The designed DNA sequence was excised from the supplied plasmid DNA and inserted into appropriately cut pET28, using T4 DNA ligase (Wako) at room temperature for 1 h. The ligation mixture was used to transform E. coli DH5α, and pET28b-MytiLec was prepared from cultures using QIAprep (Qiagen). This vector directs expression of full-length MytiLec carrying a thrombin-cleavable hexa-histidine tag at the N-terminus. The final purified protein product, after tag removal, has a sequence beginning with GSHMATF.
9
CRISPR-Cas9 Mediated Zebrafish aipl1b Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide RNA (gRNA) was designed using the webpage http://crispr.mit.edu/ . A 20 bp sequence targeted to exon 1 of the aipl1b gene, ACGTATCTGCTAAACCATCC, was selected as gRNA-1. A chimeric sgRNA, consisting of pT7-gRNA17 (link) and the AIPL1b target sequence, was generated by in vitro transcription using a MEGAscript T7 kit (Ambion), and purified with an RNeasy kit (Qiagen). For Cas9 preparation, we used pCS-nCas9n, a PCS2 plasmid construct that expresses nls-zCas9-nls17 (link). Capped mRNA encoding nls-zCas9-nls was synthesized using a mMESSAGE mMACHINE SP6 kit (Ambion). Poly(A) tailing was added with E. coli Poly (A) Polymerase (NEB# M0276), and then purified by column purification (QIAprep, Qiagen). A mix of 30 ng/μL of sgRNA and 75 ng/μL nls-zCas9-nls RNA was injected into one-cell- stage zebrafish embryos. The F1 generation was produced by a pair-wise cross of the F0-injected adult fish. F1 fish in which deletion or insertion occurred at the target region of exon1 were identified by PCR amplification of the target region. By this means, we established a fish line that has a 17 bp insertion, as a new allele of the gosh mutant (goshoki6), which produces truncated Aipl1b due to an immature stop codon in exon 1.
10
Sequencing and SNP Identification in Solanum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed to anneal around at least one exonic region of the following genes: Sopen02g021920, Sopen12g030570, Sopen11g028610, and Sopen12g032710 (supplementary file S6 , Supplementary Material online). Genes were amplified from DNA extracted from each of the individual plants used in our pool with Q5 polymerase (NEB), using the manufacturer’s recommendations. Amplified gene fragments were purified (Qiaprep Qiagen) and sequenced directly, or ligated into the pENTR-TOPO2.1 vector (Life technologies) and transformed into Escherichia coli TOP10 cells. Positive colonies were selected and plasmid DNA was extracted using Qiagen Qiaprep.
To identify all SNPs at each gene segment, we sequenced at least two plasmids per plant. We used CodonCode Aligner (CodonCode Inc) to check the sequence quality and align the plasmid sequenced with the reference genes. Up to 21 SNPs were manually annotated for each gene section.
To identify all SNPs at each gene segment, we sequenced at least two plasmids per plant. We used CodonCode Aligner (CodonCode Inc) to check the sequence quality and align the plasmid sequenced with the reference genes. Up to 21 SNPs were manually annotated for each gene section.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!