Telomere lengths were measured on paraffin-embedded sections of lung tissue by Quantitative Fluorescence in Situ Hybridization (Q-FISH). Briefly, after deparaffinixation, tissues were suspended in 10mM sodium citrate buffer, pH 6.5, heated in a microwave, then incubated for 15 min in 0.01M HCL containing 1% pepsin (Thermofisher Scientific, South San Francisco, CA). The tissues were washed then treated with 10mg/ml RNase solution (Qiagen, Hilden, German). After washing, the tissues were incubated with 0.3 μg/ml PNA probe TelC-Cy3 (Panagene, Daejeon, Korea) suspended in formamide buffer (70% formamide, 10 mmol/L Tris, pH 7.5), heated to 78°C for 10 min then incubated overnight at 20°C. The tissues were then washed sequentially with formamide buffer then PBS containing 0.1% Tween, blocked with 3% BSA (Sigma, St. Louis, MO), 10% donkey serum and incubated overnight at 4°C with rabbit-anti SPC antibody (MilliporeSigma). Tissues were washed with PBS containing 0.1% Tween and incubated secondary antibody at 20°C for 1 h, washed, and mounted using prolong gold anti-fade mounting medium with DAPI (Life Technologies). Images were acquired using a Zeiss Axio Imager 2 microscope (Zeiss, Oberkochen, Germany) and telomere signal intensity was quantified in a blinded manner using MetaMorph imaging analysis software (Molecular Devices, Sunnyvale, CA).
Rnase solution
Manufactured by Qiagen
Sourced in United States
The RNase solution is a laboratory reagent used to degrade ribonucleic acid (RNA) molecules. It is a commonly used tool in molecular biology and biochemistry protocols.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (3 mentions)
Dnase 1, by Qiagen (3 mentions)
Proteinase k solution, by Qiagen (3 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Dneasy blood and tissue kit, by Qiagen (2 mentions)
Prolong gold antifade mounting medium with dapi, by Thermo Fisher Scientific (1 mentions)
Axio imager 2 microscope, by Zeiss (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Hydrochloric acid (hcl), by Thermo Fisher Scientific (1 mentions)
Metamorph imaging analysis software, by Molecular Devices (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Gel dox xr imaging system, by Bio-Rad (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Isolate 2 genomic dna kit, by Meridian Bioscience (1 mentions)
6 protocols using rnase solution
1
Quantitative Fluorescence in Situ Hybridization for Telomere Length Measurement
2
Confirming Cell Line Identity via PCR and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mycoplasma testing 1 mL of conditioned medium was heated for 5min at 95°C. A PCR reaction was set up with the following primers: forward (5′GGGAGCAAACAGGATTAGATACCCT3′); reverse (5′TGCACCATCTGTCACTCTGTTAACCTC3′). PCR products were loaded on a 1% w/v agarose gel, run at 110 V for 30 minutes in TAE buffer and observed with a Gel Dox XR+ imaging system (Bio-Rad). To confirm cell line identity, DNA extraction was performed using the DNeasy Blood & Tissue Kit (QIAGEN). Confluent cells were dissociated from 6-well plates and lysed in protein K solution; 4 μL of 100mg/ml RNase solution (QIAGEN) was added and DNA was purified through the spin-column and eluted in 150 μl. DNA quality was confirmed with a nanodrop spectrophotometer (Nanodrop 2000, Thermo scientific) and on a 1% agarose gel. DNA samples were sequenced using STR profiling at the Wellcome Trust Sanger Institute.
3
Extraction and Synthesis of DNA, RNA, and cDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA and RNA were extracted using the DNeasy Blood and Tissue Kit and RNeasy Mini Kit (both Qiagen, Valencia, CA, USA), respectively, according to the manufacturer’s protocol. DNA samples were treated with RNase solution (Qiagen) and Proteinase K solution (Qiagen) at 65 °C for 10 min while RNA samples were treated with DNase I (Qiagen) for 20 min. cDNA was synthesised from 1 μg of total RNA using oligo(dT) primers and the Superscript III First-Strand synthesis system (Thermo Fisher, Scoresby, VIC, Australia), according to the manufacturer’s instructions.
4
DNA and RNA Extraction from Cell Pellets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA and RNA were extracted from cultured cell pellets using the ISOLATE II Genomic DNA Kit (Bioline, London, UK) and RNeasy Mini Kit (Qiagen, CA, USA), respectively, according to the manufacturer's protocols with minor modifications. The DNA samples were treated with 3 μl of RNase solution (Qiagen) and Proteinase K Solution (20 μg/μl; Qiagen) at 65°C for 10 min and the RNA samples were treated with DNase I (3 kunitz units/ μl; Qiagen) for 20 min.
5
Nucleic Acid Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA and RNA were extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) and RNeasy Mini Kit (Qiagen), respectively, as described in Dickinson et al.17 (link) The DNA samples were treated with RNase solution (Qiagen) and Proteinase K Solution (Qiagen) at 65 °C for 10 min and RNA samples were treated with DNase I (Qiagen) for 20 min.
6
Genomic DNA Extraction from Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted from the tumours using the DNeasy Blood & Tissue Kits (Qiagen, CA, USA), according to manufacturer’s protocols with minor modifications. The DNA samples were treated with 3 μL of RNase solution (Qiagen) at room temperature. DNA samples were eluted in 100 μL of autoclaved Milli-Q H2O.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!