Veriti 96 well

The viral RNA was reverse transcribed applying the Superscript IV First-Strand Synthesis System (Invitrogen) using random hexamers according to the manufacturer’s recommendations. The reverse transcription reaction was carried out at 23°C for 10 min, 55°C for 10 min and 80°C for 10 min. Further, the viral RNA was amplified by conventional PCR using GoTaq Green Master Mix (Promega) according to the manufacturer’s recommendations. The set of primers utilized in this procedure were: ZK3F, 5' GCTACTGGATTGAGAGTGAGAAG 3', and ZK2R, 5' CTCAGAGATGGTCCTCTTGTTC 3´ for ZIKV; CHIK E1 F, 5´TACCCATTCATGTGGGGC3´ and CHIK E1R, 5´GCCTTTGTACACCACGATT 3´ [32 (link)]; and DEN F, 5´ TCAATATGCTGAAACGCG CGAGAAACCG 3´ and DEN R, 5´ TTGCACCAACAGTCAATGTCTTCAGGTTC3´ for DENV [33 (link)]. The thermocycling program set up in a Veriti 96 Well thermocycler (Applied Biosystem) was 1 cycle of 95°C for 5 min; 40 cycles of 95°C for 40 sec, 50°C for 40 sec, 72°C for 30 sec; 1 cycle of 72°C for 10min and hold of 4°C. 10 ml of Amplified products were detected by electrophoresis on a 2% agarose gel, visualized by ethidium bromide staining UV.

This procedure was carried out using INgene Bruce ladder (INgene Bruce ladder V®: Batch No 180515, Ingenasa, Madrid, Spain). The kit included five primer pairs (Table 5) designed on the strain-specific genetic differences. This technique was used for molecular typing of different Brucella at the species level [20 (link)]. DNA was amplified by PCR (Veriti 96 well, Applied Biosystem, USA) where cycling was initiated by denaturing at 95 °C temperature for 4 min, then 35 cycles at 94 °C for 45 s, 45 s at 60 °C, 60 s at 72 °C then 72 °C for 7 min for final extension. An ethidium bromide (0.5 μg/mL)-stained 1% agarose gel was used for analysis of PCR fragments. The gels’ results obtained by UV illumination were saved in a documentation and analysis system. Identification of Brucella species was based on the corresponding molecular size of amplified fragments in a parallel DNA ladder (100 bp and 1Kb).
Table 5

Primer sets for Bruce ladder multiplex PCR

Primer	Sequence (5′–3′)	Amplicon size (bp)
BMEI0998f BMEI0997r	ATC-CTA-TTG-CCC-CGA-TAA-GG GCT-TCG-CAT-TTT-CAC-TGT-AGC	1682
BMEII0843f BMEII0844r	TTT-ACA-CAG-GCA-ATC-CAG-CA GCG-TCC-AGT-TGT-TGT-TGA-TG	1071
BMEII0428f BMEII0428r	GCC-GCT-ATT-ATG-TGG-ACT-GG AAT-GAC-TTC-ACG-GTC-GTT-CG	587
BR0953f BR0953r	GGA-ACA-CTA-CGC-CAC-CTT-GT GAT-GGA-GCA-AAC-GCT-GAA-G	272
BMEI0752f BMEI0752r	CAG-GCA-AAC-CCT-CAG-AAG-C GAT-GTG-GTA-ACG-CAC-ACC-AA	218

DNA was isolated with the QIAamp DNA extraction kit (Qiagen, Inc., Hilden, Germany; Cat. No. 51104) as instructed in the reaction kit. To detect the IL-6 G174C polymorphism (rs1800795), we used the polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP) method. Each amplification reaction used Promega GoTaq^® Green Master Mix (Cat. no. M7122, Promega, Madison, WI, USA) in A DNA thermal cycler machine (Applied Biosystems Veriti 96 Well). The primers used were: Forward: 5′-TGACTTCAGCTTTACTCTTTG-3′, Reverse: 5′-CTGATTGGAAACCTTATTAAG-3′ (198 bp amplicon). The procedure includes initial denaturation at 95 °C–5′, 40 cycles: 95 °C–30″, 52 °C–30″, 72 °C–45″, and final extension at 72 °C–5′. PCR products were then incubated with restriction enzyme NIaIII (Cat. No. R0125S, New England Biolabs, Ipswich, MA, USA) at 37 °C for 4 h [34 (link)]. The results of the PCR-RFLP showed 119 and 49 bp bands for minor homozygote (SNP) CC genotype, 30 and 168 bp for major homozygote GG genotype, and three bands (168, 119, and 49 bp) for heterozygote CG genotype. We also performed direct sequencing to confirm the results of the PCR-RFLP.