First strand cdna synthesis kit

Total RNA was extracted using a total RNA isolation kit (FOREGENE, Chengdu, China) according to the manufacturer's instructions. A reverse transcription reaction was performed using a First-Strand cDNA synthesis kit (Bimake, Houston, TX, USA) with 1 μg of RNA in a final volume of 10 μl. The newly synthesized cDNA was then used as the template for quantitative real-time PCR (qRT-PCR), which was carried out using 2 × SYBR Green qPCR Master Mix (Bimake). Reactions were processed and analyzed on a Quantstudio-3-Real-time-PCR system (ThermoFisher, Waltham, MA, USA). The PCR conditions were 5 min at 95°C, followed by 45 cycles of 95°C for 15 s and 60°C for 1 min. All qRT-PCRs were run in triplicate, and data were analyzed according to the comparative Ct (2^−ΔΔCt) method. The qRT-PCR primers were synthesized by Sangon Biotech (Shanghai, China): FUT9 (forward, CTCTGTGCTGAAAATGAAAAACTT; reverse, TTGTGAGATGGCATCCTTGG), POU2F1 (forward, CGCAAAATCTTCTAACGCAAC; reverse, GGCTCTGTGGAAGTGTCTGAAT), MUC4 (forward, AGTAAAAACTACGAGCAGGCGAA; reverse, TTGTAGGCTTCAATCACACGACC), RAB14 (forward, AAGGAATCTCACCAATCCAAATAC; reverse, ATCTTCTACATTCTCTCCCGTTTT), and GAPDH (forward, ATCATCAGCAATGCCTCC; reverse, CATCACGCCACAGTTTCC). Experiments were carried out independently three times.

Total RNA was isolated using TRIzol Reagent (Takara) according to the manufacturer's instructions. The concentration of RNA was determined by measuring the optical density at wavelengths of 260 nm and 280 nm. 1 μg of the total RNA was used to generate cDNA with the First Strand cDNA Synthesis kit (Bimake). Then, qPCR was performed using FastStart Universal SYBR Premix ExTaqTM II (Takara Biotechnology) on an ABI PRISM^® 7900HT System (Applied Biosystems). The relative gene expression was analysed by the relative standard curve method (2^−ΔΔCT) with Gapdh as the reference. The primers used for qPCR are listed in Table S1.

TRIzol Reagent (Takara) was used to isolate the total RNA. The quantification of RNA concentration was accomplished through the assessment of optical density at 260 nm and 280 nm wavelengths. 1 μg of the total RNA was employed for the production of cDNA by the First Strand cDNA Synthesis kit (Bimake). Then, we performed qPCR on an ABI PRISM® 7900HT System (Applied Biosystems). The relative gene expression was assessed using the relative standard curve method (2^−ΔΔCT), with Gapdh serving as the reference gene. The primer sequences were documented in Table S2. Each sample was subjected to independent analysis, which was performed three times.