Log In Sign up
The largest database of trusted experimental protocols

Sybr green containing mastermix

Manufactured by Primerdesign
Visit Supplier

The SYBR green-containing mastermix is a ready-to-use solution designed for the detection and quantification of DNA sequences through real-time PCR. It includes the necessary components, including the SYBR green dye, to enable efficient amplification and fluorescent signal detection.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) Superscript vilo kit, by Thermo Fisher Scientific (3 mentions) Dnase free kit, by Thermo Fisher Scientific (3 mentions)

Spelling variants of this product

SYBR green (24 citations) SYBR green mastermix (8 citations) Precision plus qPCR Mastermix containing SYBR green (3 citations)

3 protocols using sybr green containing mastermix

1

qPCR Analysis of Small GTPases in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from cells using RNeasy Mini Kits (Qiagen). Contaminating DNA was used with a DNase-free kit (Ambion). For complementary DNA (cDNA) synthesis, a SuperScript VILO Kit was used (Invitrogen). qPCR was carried out with cDNA using SYBR Green-containing Master Mix (Primer Design). GADPH was used as a reference gene. The qPCR oligonucleotide primers used for RhoH were as follows: F, GAGAAGTAACATTCTGCAAATCGC R, AGCACACGCCATTCAGCAAG; for Rac2: F, GCAAGACCTGCCTTCTCATCA R, GCTGTCCACCATCACATTGG; for RhoA: F, CAACTATGATTATTAACGATGTCCAACC R, TGGTGTGTCAGGTGGGAGTG; and for GAPDH: F, GTGAAGGTCGGAGTCAACG R, TGAGGTCAATGAAGGGGTC.
Tajadura-Ortega V., Garg R., Allen R., Owczarek C., Bright M.D., Kean S., Mohd-Noor A., Grigoriadis A., Elston T.C., Hahn K.M, & Ridley A.J. (2018). An RNAi screen of Rho signalling networks identifies RhoH as a regulator of Rac1 in prostate cancer cell migration. BMC Biology, 16, 29.
+ Open protocol
+ Expand
2

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from cells using RNeasy Mini kits (Qiagen). Contaminating DNA was removed with a DNase-free kit (Ambion). cDNA was synthezied using a SuperScript VILO kit (Invitrogen). Quantitative real-time PCR (qPCR) was carried out with cDNA using SYBR green-containing mastermix (Primer Design) using PUM1 as a reference gene. The following oligonucleotides were used to test the expression of IDO1: F: 5′-ACAGACCACAAGTCACAGCG-3′ R: 5′-GGACATCTCCATGACCTTTG-3′ and PUM1: F: 5′- GATTATTCAGGCACGCAGGT-3′ R: 5′-AGCAGCGCTGATGATGTATG-3′.
Beatson R., Tajadura-Ortega V., Achkova D., Picco G., Tsourouktsoglou T.D., Klausing S., Hillier M., Maher J., Noll T., Crocker P.R., Taylor-Papadimitriou J, & Burchell J.M. (2016). MUC1 modulates the tumor immune microenvironment through the engagement of Siglec-9. Nature immunology, 17(11), 1273-1281.
+ Open protocol
+ Expand
3

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from cells using RNeasy Mini kits (Qiagen). Contaminating DNA was removed with a DNase-free kit (Ambion). cDNA was synthezied using a SuperScript VILO kit (Invitrogen). Quantitative real-time PCR (qPCR) was carried out with cDNA using SYBR green-containing mastermix (Primer Design) using PUM1 as a reference gene. The following oligonucleotides were used to test the expression of IDO1: F: 5′-ACAGACCACAAGTCACAGCG-3′ R: 5′-GGACATCTCCATGACCTTTG-3′ and PUM1: F: 5′- GATTATTCAGGCACGCAGGT-3′ R: 5′-AGCAGCGCTGATGATGTATG-3′.
Beatson R., Tajadura-Ortega V., Achkova D., Picco G., Tsourouktsoglou T.D., Klausing S., Hillier M., Maher J., Noll T., Crocker P.R., Taylor-Papadimitriou J, & Burchell J.M. (2016). MUC1 modulates the tumor immune microenvironment through the engagement of Siglec-9. Nature immunology, 17(11), 1273-1281.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!