Primary cell nucleofection solution

Cas9/RNP nucleofection of P14 cells was performed as described previously(33 (link)). Briefly, P14 cells were isolated and activated as described above. While cells were maintained in culture, single guide RNAs for Zeb2 or Cd4, and Cas9 protein were mixed by pipetting up and down and pre-complexed at room temperature for at least 10 min. After this period, 1–10 million activated P14 cells were re-suspended in 20 μL primary cell nucleofection solution (Lonza), then mixed and incubated with the crRNA/Cas9 mix for 2 min at room temperature. The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit; Lonza). After nucleofection, prewarmed complete RPMI was used to transfer transfected P14 cells in 96-well plates. After 2 h, P14 cells were cultured in 24-well plates in complete RPMI (+ IL-2 – 10 ng/ml) for 48 h, before adoptive transfer into recipient mice (1 × 10⁵ cells/mouse). Knockout efficiency was assessed using Sanger-based sequencing (Genewiz/Azenta), followed by analysis using the ICE platform (Synthego). The single guide RNAs used were Cd4_1: UCUUCCCUUGAGUGACAGCU; Cd4_2: CAACUCCUAGCUGUCACUCA; Zeb2_1: CCUGGUCCAGAGGGUUUGCA; Zeb2_2: GGUGAACUAUGACAACGUAG.

Cas9/RNP nucleofection of P14 cells was performed as described previously (Seki and Rutz, 2018 (link)). Briefly, P14 cells were isolated and activated as described above. While cells were maintained in culture, single guide RNAs for P2rx7 (sgP2rx7), Cd19 (sgCd19) or scrambled control (sgControl) and Cas9 protein were mixed by pipetting up and down and pre-complexed at room temperature for at least 10 min. After this period, 1–10 million activated P14 cells were re-suspended in 20 μL primary cell nucleofection solution (Lonza), then mixed and incubated with the crRNA/Cas9 mix for 2 min at room temperature. The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit; Lonza). After nucleofection, prewarmed complete RPMI was used to transfer transfected P14 cells in 96-well plates. After 2 h, P14 cells were cultured in 24-well plates in complete RPMI for 48 h, before adoptive transfer into recipient mice.