Rna extraction kit

Manufactured by Zymo Research

Sourced in United States

The RNA extraction kit is a laboratory tool designed to isolate and purify RNA from various biological samples. It utilizes a specialized procedure to efficiently extract and recover high-quality RNA for downstream applications, such as gene expression analysis, reverse transcription, and molecular biology experiments.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Direct-zol RNA extraction kit (97 citations) Quick RNA extraction kit (8 citations) Direct-zol RNA Miniprep extraction kit (8 citations) Quick-RNA™ MiniPrep extraction kit (4 citations) Direct-zol RNA Miniprep Plus extraction kit (4 citations) Zymo Viral RNA Extraction Kit (4 citations) Total RNA extraction kit (3 citations) YeaStar RNA extraction kit (3 citations) Direct-zol RNA extraction kit with DNase I treatment (2 citations) Quick-RNA extraction mini prep kit (2 citations)

66 protocols using rna extraction kit

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
RNA was extracted from cells using commercial RNA extraction kits (Zymo Research). RNA (1ug) was reverse transcribed using cDNA synthesis kits (Thermo). QRT-PCRs were performed using SyBr Green PCR kits on a Thermocycler with primers specific for alpha SMA (Forward: TGTATGTGGCTATCCAGGCG; Reverse: AGAGTCCAGCACGATGCCAG), CLIC4 (Forward: CATCCGTTTTGACTTCAGTGTTG;
GGACCTGCAGACGGTTATCC; Reverse: AGCCTCCTGGAGATGTGCAT), GLI2 (Forward: TTTATGGGCATCCTCTCTGG; Reverse: TTTTGCATTCCTTCCTGTCC) and GAPDH (Forward: ACCCACTCCTCCACCTTTGA; Reverse;
CTGTTGCTGTAGCCAAATTCGT). Data were analysed using the ΔΔCt method using GAPDH as a housekeeping control gene.

Wasson C.W., Caballero-Ruiz B., Mankouri J., Canettieri G., Galdo N.A.R., & Galdo F.D. (2021). Chloride intracellular channel 4 (CLIC4) expression is transcriptionally regulated by crosstalk of the TGF-β, Wnt and Hedgehog signalling pathways.

+ Open protocol

+ Expand

CeA Transcriptional Profiling in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rats were anesthetized with isoflurane and rapidly decapitated. Brains were harvested, flash frozen in dry ice-cooled isopentane, and stored at -80 °C until analysis. The CeA was dissected from coronal cryostat sections (400 μm) using a stainless-steel punch. mRNA was isolated from the CeA using Trizol (Invitrogen; catalog no. 15596026) and RNA extraction kits (Zymo Research; catalog no. NC9972645). cDNA synthesis was conducted using SuperScript IV exDNAse kits (Invitrogen; catalog no. 11766050). cDNA was amplified using SYBR green PowerTrack master mix (Applied Biosystems; catalog no. A46109) and quantified by quantitative polymerase chain reaction (qPCR) on the QuantStudio 5 system. Crh, Crhr1, Fkbp5, Bdnf, Nr3c1, Calca, Il18, Il18bp, Ramp1, Crlr-1, Iapp, and Glp-1r mRNA fold changes are expressed relative to unstressed controls and were normalized to the validated and stable housekeeping gene, β-actin (Actb) [40] . Cycling conditions were the following: 95 °C denaturation temperature for 15 s, 60.3 °C annealing temperature for 15 s, and 72 °C extension temperature for 15 s. Primers were obtained from Integrated DNA Technologies (Coralville, IA, USA). See Table 1 for all forward and reverse primer sequences. Specificity was confirmed as a single product in the melt curve analysis.

Cruz B., Vozella V., Borgonetti V., Bullard R., Bianchi P.C., Kirson D., Bertotto L.B., Bajo M., Vlkolinsky R., Messing R.O., Zorrilla E.P, & Roberto M. (2024). Chemogenetic inhibition of central amygdala CRF-expressing neurons decreases alcohol intake but not trauma-related behaviors in a rat model of post-traumatic stress and alcohol use disorder. Molecular psychiatry.

+ Open protocol

+ Expand

Macrophage-mediated SARS-CoV-2 Viral Entry

Check if the same lab product or an alternative is used in the 5 most similar protocols

C57BL/6J wild type and LDLR KO (B6.129S7-Ldlr^tm1her/J) mice were intraperitoneally injected by 3% brewer thioglycollate medium (Millipore-Sigma, St. Louis, MO, USA). Mouse peritoneal cavity elicited macrophages (MØ) were collected, isolated, and cultured in serum-free DMEM/F12 medium for overnight prior to Spp viral entry assay. Primary hDMVECs were cultured in EC medium with 5% FBS. Cardiomyocytes-like H9C2 cells (ATCC, Manassas, VA, USA) were cultured in DMEM (10% FBS) medium. Both hDMVECs and H9C2 cells are plated to 60% confluence and were incubated with 2% LD-FBS (cholesterol levels <0.8 μg/mL) in the medium for overnight prior to assays. Spp virus (4.8x10⁷ particles) was incubated with human LDL-c (12.5 μg) for one hour at room temperature. The Spp lentivirus alone or Spp/LDL-c mixture containing the same quantity of viral particles were added into cells and incubate through 30 minutes to 16 hours. The cells were washed by PBS three time and RNAs were extracted using a Zymo RNA extraction kit. The uptake of Spp virus by cells was determined using a real time RT-PCR. Beta-actin was used as an internal amplification control for normalization. For inhibitory experiments, a scavenger receptor class B type 1 (SRB1) antagonist, block lipid transport-1(BLT-1), was added into the cells to a final concentration of 10 μM for 2 hrs prior to addition of the Spp virus.

Cao X., Nguyen V., Tsai J., Gao C., Tian Y., Zhang Y., Carver W., Kiaris H., Cui T, & Tan W. (2023). The SARS-CoV-2 Spike protein induces long-term transcriptional perturbations of mitochondrial metabolic genes, causes cardiac fibrosis, and reduces myocardial contractile in obese mice. bioRxiv.

+ Open protocol

+ Expand

Detailed Cytokine Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were purchased from Sigma-Aldrich (Oakville, ON, Canada). Bacteria culture medium was purchased from Fisher Scientific (Ottawa, ON, Canada). U937 cell culture medium and heat-inactivated fetal bovine serum (HI-FBS) were purchased from Corning (Corning, NY, USA). RNA extraction kit was acquired from Zymo Research (Irvine, CA, USA). Duoset interleukine-1β (IL-1β), tumor necrosis factor alpha (TNF-α) and interleukine-6 (IL-6) ELISA kits were purchased from R&D Systems (Toronto, ON, Canada).

Minne X., Mbuya Malaïka Mutombo J., Chandad F., Fanganiello R.D, & Houde V.P. (2023). Porphyromonas gingivalis under palmitate-induced obesogenic microenvironment modulates the inflammatory transcriptional signature of macrophage-like cells. PLOS ONE, 18(6), e0288009.

+ Open protocol

+ Expand

Methylation Analysis of Iron Storage Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from BMSCs and purified using an RNA extraction kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. The RNA was treated with bisulfite and PCR was performed under the following conditions: predenaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 40 s, and 72 °C for 40 s, with a final extension at 72 °C for 10 min. The methylation status of the Fth1 and Ftl genes was qualitatively analyzed using gel electrophoresis (1× TAE) and methylation-specific PCR, gene sequencing, and direct bisulfite sequencing. The primer sequences are listed in Supplementary Table 2.

Liu J., Ren Z., Yang L., Zhu L., li Y., Bie C., Liu H., Ji Y., Chen D., Zhu M, & Kuang W. (2022). The NSUN5-FTH1/FTL pathway mediates ferroptosis in bone marrow-derived mesenchymal stem cells. Cell Death Discovery, 8, 99.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNA extraction kit (Zymo Research, Irvine, CA, USA) was used to extract total RNA, which was reverse transcribed into cDNA using the cDNA Synthesis Kit (ABI, Foster City, CA, USA). The cDNA was amplified with SYBR Premix (Roche, Basel, Switzerland) using a Light Cycler 96 Real‐Time PCR System (Roche, Basel, Switzerland). The PCR cycling parameters were 95°C for 10 min, then 95°C for 10 s, 60°C for 10 s, and 72°C for 20 s repeated 40 times. A single primer for each sample was carried out in triplicate. Relative mRNA levels were calculated by comparative Ct method (Applied Biosystem instruction manual) and presented by their ratio to their biological controls. The fold change in expression of each target mRNA relative to GAPDH was calculated as 2^Δ(ΔCt), where ΔCt = ΔCt_GAPDH‐Ct_gene. GAPDH transcript levels were confirmed to correlate well with total RNA amounts and therefore were used for normalization throughout. The primers used for real‐time PCR were designed by primer bank (http://pga.mgh.harvard.edu/primerbank/).

Gampala S., Zhang G., Chang C.J, & Yang J. (2021). Activation of AMPK sensitizes medulloblastoma to Vismodegib and overcomes Vismodegib‐resistance. FASEB BioAdvances, 3(6), 459-469.

+ Open protocol

+ Expand

Quantitative RNA Analysis of Plant-Pathogen Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the systemically infected leaves of N. benthamiana or soybean using the Zymo RNA Extraction kit. A DNase treatment step was always included to eliminate potential contamination of plant genomic DNA. The quality of the RNA samples was assessed first with a NanoDrop spectrometer, followed by agarose gel electrophoresis to determine the RNA integrity. For sqRT-PCR, an equal amount (usually 1 µg) of RNA was used for all samples in the same experimental group, and the 1st strand cDNA synthesis was primed with a poly-dT primer. At the PCR step, a pair of soybean actin 1 primers were used to amplify a cDNA fragment that serves as a control to ensure that cDNA synthesis in all samples was initiated with an equivalent amount of mRNA. Various primer pairs (Additional file 1: Table S1) that amplify either viral (e.g., CPSMV RNA2) or plant (e.g., GmPDS1) cDNAs were used to assess the levels of the corresponding mRNAs.

Zaulda F.A., Yang S.H., Han J., Mlotshwa S., Dorrance A, & Qu F. (2022). A cowpea severe mosaic virus-based vector simplifies virus-induced gene silencing and foreign protein expression in soybean. Plant Methods, 18, 116.

+ Open protocol

+ Expand

RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was prepared with RNA Extraction Kit (Zymo) and quantified by Nanodrop. Then, cDNA was prepared by Superscript^™ III First-Strand Synthesis System Kit was applied on 1 μg of RNA, and the CT value was measured using Applied Biosystems^™ StepOnePlus^™ Real-Time PCR System, and each mean dCT was averaged from triplicates. The relative expression level was measured by ddCT according to GAPDH control as previously described ^{22 (link)}.

Liang Z., Gilbreath C., Liu W., Wang Y., Zhang M.Q., Zhang D.E., Wu S, & Fu X.D. (2023). Chromatin-associated RNA Dictates the ecDNA Interactome in the Nucleus. bioRxiv.

+ Open protocol

+ Expand

qPCR Analysis of Mitotic Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mitotic and interphase cells were separated by mitotic shake-off and RNA was extracted using the Zymo RNA extraction kit according to the manufacturer’s instructions. cDNA was generated using an RNA to cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was mixed with the specified primers and SYBR green PCR master mix (Thermo Fisher Scientific) and 40 cycles of real-time PCR were carried out on a QuantStudio 7 Pro Real-Time PCR System (Thermo Fisher Scientific). We performed 3 biological replicates of each condition, and qPCR was carried out for each of these in 3 technical replicates. Data were analysed using the ddCT method [37 (link)] normalised to the geometric mean of two housekeeping genes: 18S and HPRT1. Statistical analysis was conducted by a paired t-test, and the mitotic enriched samples were compared to the corresponding control. Data were analysed via Prism.

Watson S., Porter H., Sudbery I, & Thompson R. (2024). Modification of Seurat v4 for the Development of a Phase Assignment Tool Able to Distinguish between G2 and Mitotic Cells. International Journal of Molecular Sciences, 25(9), 4589.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from was extracted using an RNA Extraction Kit (Zymo #R1050) and subjected to reverse transcription using RT Master Mix (Applied Biosystems #4368814). qPCR was performed with SYBR Green Master Mix (Applied Biosystems #4309155). qPCR primers used are listed in Supplementary Table S3.

Jacobs C., Shah S., Lu W.C., Ray H., Wang J., Hockaden N., Sandusky G., Nephew K.P., Lu X., Cao S, & Carpenter R.L. (2023). HSF1 Inhibits Antitumor Immune Activity in Breast Cancer by Suppressing CCL5 to Block CD8+ T-cell Recruitment. Cancer Research, 84(2), 276-290.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!