For the HCRTR2 polymorphism rs2653342, randomly selected samples were additionally genotyped by pyrosequencing to confirm the TaqMan® assay results, where the distinction between the 3 genotype clusters was consistently poor. Primers (forward: 5′‐CTCGCTGTCATCTTT GTATCCC‐3′; reverse: 5′‐TCGGAGTAACTGGGCAATAGA‐3′) for the preceding PCR and the pyrosequencing primer (5′‐CCTATAAATAGCAC‐3′) were designed using the web‐based softwares Primer332 and mfold.33 Primer sequences were screened on the NCBI webpage (http://blast.ncbi.nlm.nih.gov/Blast.cgi ) to confirm specificity. The PCR was carried out using a non‐biotinylated forward and a biotinylated reverse primer as well as Taq polymerase (Thermo Scientific, Ulm, Germany) to amplify fragments. The biotinylated PCR products were immobilized onto streptavidin‐coated sepharose beads (GE Healthcare, Uppsala, Sweden) using a PyroMark® vacuum prep tool (QIAGEN), denatured and purified in 70% ethanol, 0.2 M NaOH, and washing buffer according to manufacturer’s instructions, and finally annealed to the sequencing primer for 2 minutes at 80ºC. The SNP was analyzed using a PyroMark® Reagent Kit and Q96 ID system (QIAGEN). Samples rerun with pyrosequencing corresponded 100% with the TaqMan® assay results for the 3 different genotypes, and the original TaqMan® results were therefore considered reliable.
Pyromark vacuum prep tool
Manufactured by Qiagen
Sourced in Sweden, Germany
The PyroMark Vacuum Prep Tool is a laboratory equipment designed for sample preparation in pyrosequencing analysis. It is used to purify and prepare DNA samples for the PyroMark pyrosequencing system.
Automatically generated - may contain errors
Lab products found in correlation
Streptavidin coated sepharose beads, by GE Healthcare (2 mentions)
Pyromark q24, by Qiagen (2 mentions)
Taq polymerase, by Thermo Fisher Scientific (1 mentions)
Pyromark q24 system, by Qiagen (1 mentions)
Epik amplification kit, by Meridian Bioscience (1 mentions)
Ez dna methylation lightning kit, by Zymo Research (1 mentions)
Psq hs 96a instrument, by Qiagen (1 mentions)
Pyromark wash buffer, by Qiagen (1 mentions)
Pyromark annealing buffer, by Qiagen (1 mentions)
Pyromark denaturation solution, by Qiagen (1 mentions)
Gentra puregene blood kit, by Qiagen (1 mentions)
Pyromark pcr kit, by Qiagen (1 mentions)
Pyromark assay design software, by Qiagen (1 mentions)
Ez dna methylation gold kit, by Zymo Research (1 mentions)
5 protocols using pyromark vacuum prep tool
1
Validating HCRTR2 Polymorphism Genotyping
2
TACSTD2 Promoter CpG Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The EZ DNA Methylation-Lightning kit (Zymo, Cat. No. D5030) was used to bisulfite treat DNA. PCR primers were designed using the Pyromark Assay Design Software version 1.0 (Qiagen). Bisulfite-treated DNA was then amplified using the EPIK Amplification kit (Bioline, Cat. No. BIO-66025). Gene-specific primers targeting the three CpG sites in the promoter region of TACSTD2 (NM_002353) (GRCh37 HG19 Map position (MAPINFO) Ch1: 59043255, 59043280 and 59043370) analyzed by the BeadChip were designed. Primers for pyrosequencing: FWD GGTTGGGGTTGGGAAAGAA-3′, REV -Biot-5′-ACCCCACCTCCTACTACAAACCTA-3′, SEQ 5′-GGAAAGAAAGAAAAGGGA-3′. The Pyromark vacuum prep tool (Qiagen) was used to isolate single stranded products for pyrosequencing. The Pyromark Q24 system (Qiagen) was used to perform pyrosequencing reactions according to manufacturer’s protocol (Qiagen). Percent methylation at the interrogated CpG sites was determined using the Pyromark Q24 Software.
3
SNP Genotyping Workflow with PyroMark Technology
4
DNA Methylation Analysis by Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine CA, USA), 500 ng of genomic DNA from cells and FFPE tissue samples was modified by bisulfite conversion. As described in the user’s manual and in Kreutz et al.23 (link), PCR was performed with the PyroMark PCR Kit using 2 µl of the bisulfite-converted DNA. The PyroMark CpG Assay PCR primer set (Qiagen) and three self-designed primer pairs using PyroMark Assay Design Software were used. Primer sequences can be found in Supplementary Fig. 1 . The PCR product was prepared for pyrosequencing using the PyroMark vacuum prep tool (Qiagen). Using the corresponding sequencing primers for our four primer pairs, the samples were analysed by PyroMark Q24 (Qiagen). The results were evaluated using PyroMark Q24 Software (Qiagen). In total, 21 CpG dinucleotides were analysed for all DNAs extracted from cells. For the DNA isolated from human tissue slices, CpG Primer1 could not be used, resulting in 17 analysed CpG sites. 10 cases were exemplarily analysed for all 17 sites, for the majority only 6 CpG Dinucleotides were analysed using the PyroMark CpG Assay PCR primer set. The details for the whole sequence with all CpG dinucleotides can be found in the Supplementary materials (Supplementary Fig. 1 ).
5
Mutation Analysis of IDH1 and IDH2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Portions of the IDH1 and IDH2 genes were amplified, spanning mutation sites in codon 132 (IDH1) and codon 172 (IDH2), respectively. Thermal cycling consisted of 45 cycles of denaturing (95 °C, 30 s), annealing (53 °C, 30 s), and elongation (72 °C, 30 s) steps, preceded by an initial denaturation step (95 °C, 15 min) and followed by a final elongation step (72 °C, 6 min). A pyrosequencing analysis was performed with a PyroMark Q24 Qiagen system. Briefly, single-stranded DNA was prepared from 20 μL of a biotinylated PCR product with streptavidin-coated Sepharose beads (GE Healthcare, Chicago, IL, USA) and 0.4 mM of sequencing primers using the PyroMark Vacuum Prep Tool (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!