BMP2 wild-type 3′-UTR containing putative miR-664a-3p binding sites was inserted into the pGL3 control luciferase reporter vector (Promega, USA). To assess binding specificity, the sequence interacting with miR-664a-3p was mutated by using the Q5® Site-Directed Mutagenesis Kit Protocol (New England Biolabs), and the mutated BMP2 (BMP2-MUT) 3′-UTR was also inserted into the pGL3 plasmid. VICs were cultured in 24-well plates and transfected with Lipofectamine 3000 (Thermo Scientific). Next, 1 μg of luciferase reporter plasmid was added to each well, followed by treatment with 0.2 μg of pRL-TK Renilla luciferase plasmid (internal control), 100 pmol/well of either miR-664a-3p mimic, miR-664a-3p inhibitor, or the corresponding control. Luciferase activity was measured at 48 h posttransfection using a dual-luciferase reporter system (Promega). The ratio of firefly to Renilla luciferase activity was determined to eliminate variations in transfection efficiency [32 (link)].
Q5 site directed mutagenesis kit protocol
Manufactured by New England Biolabs
Sourced in United States
The Q5® Site-Directed Mutagenesis Kit Protocol is a laboratory tool used to introduce specific mutations into DNA sequences. It provides a simple and efficient method for site-directed mutagenesis without the need for specialized equipment or complex procedures.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter system, by Promega (1 mentions)
Pgl3 control luciferase reporter vector, by Promega (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Zymopure plasmid miniprep kit, by Zymo Research (1 mentions)
Dpni, by New England Biolabs (1 mentions)
Miniprep kit, by Corning (1 mentions)
Sanger sequencing, by Source Bioscience (1 mentions)
Q5 master mix, by New England Biolabs (1 mentions)
Lr clonase, by Thermo Fisher Scientific (1 mentions)
Bp clonase, by Thermo Fisher Scientific (1 mentions)
Hygromycin b, by Thermo Fisher Scientific (1 mentions)
9 protocols using q5 site directed mutagenesis kit protocol
1
Dual-luciferase reporter assay for miR-664a-3p binding
2
Mutagenesis of DDX3X Active Sites
3
Site-Directed Mutagenesis of Wildtype Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer design was done using NEBaseChanger v1.2.7 (http://nebasechanger.neb.com/ ) and all primers produced by Eurofin Genomics Ltd. Templates DNAs (wildtypes 76D1, 76E2, and 76E4) were extracted via QIAprep Spin miniprep kit protocol. Q5 Site-directed mutagenesis kit protocol (from NewEngland Biolabs) was used to make mutants from the wildtype template DNAs. Mutagenesis was done in three stages of exponential amplification (polymerase chain reaction), digestion and transformation. Mutant plasmid DNAs was extracted via miniprep. Mutant DNAs were sequenced (Source Bioscience) to check correct mutations. The primer sequences for 76E2 D374E: forward primer TTTCACCGGGGAGCAGAAAGTCA, reverse primer GGCCTACATATCATCGGAAC; 76D1 P129T: forward primer GGTCTTTAGCACTTCTTCCGCCG, reverse primer ATCTTTGGCAGATTCATATCTTCCG; 76E4 K275L: forward primer CTTGGGAACCTTAGCTCACATGG, reverse primer CTTATGTATATGACTGACCTTG and 76D1 G347C: forward primer TTGGAACCATTGCGGATGGAACTCGTG, reverse primer AACCCTCCCACTGCTCTA.
4
Site-Directed Mutagenesis of 5-HT2C Receptor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutagenesis of the 5-HT2C construct was performed according
to the Q5 site-directed
mutagenesis kit protocol (New England BioLabs). In brief, PCR reactions
were performed using the wild-type 5-HT2C receptor cDNA
(pcDNA3.1) and primers containing the mutation sites of interest to
create mutant plasmids. After DpnI (New England BioLabs) digestion
of the parental DNA and transformation, positive clones were selected
by ampicillin resistance. DNA was prepared using the Miniprep kit
(Axygen) and sequenced (Genewiz) using forward (CMV) and reverse (BGHreverse)
sequence primers.
to the Q5 site-directed
mutagenesis kit protocol (New England BioLabs). In brief, PCR reactions
were performed using the wild-type 5-HT2C receptor cDNA
(pcDNA3.1) and primers containing the mutation sites of interest to
create mutant plasmids. After DpnI (New England BioLabs) digestion
of the parental DNA and transformation, positive clones were selected
by ampicillin resistance. DNA was prepared using the Miniprep kit
(Axygen) and sequenced (Genewiz) using forward (CMV) and reverse (BGHreverse)
sequence primers.
5
Site-directed Mutagenesis Protocol using Q5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer design was done using NEBaseChanger v1.2.7 (http://nebasechanger.neb.com/ ) and the primers synthesized by Eurofin Genomics Ltd. Templates DNAs were extracted using QIAprep Spin miniprep kit protocol. Q5 Site-directed mutagenesis kit protocol (from NewEngland Biolabs) was observed to make mutants from the wild type template DNAs. Mutagenesis was done in three stages of exponential amplification (polymerase chain reaction), digestion and transformation. Mutant plasmid DNAs were subsequently extracted via miniprep. The mutant DNAs were sent for sanger sequencing (SourceBioScience) to confirm mutations. The primer sequences are: 76E2N320S: Forward primer AGAGGAATTCAGT AGGTTGGTTTC, reverse primer GGTAAGGACTCTGTCCATTC; 76E1S318N: forward primer GGAGGAATTCAAT AGGTTGGTTT, reverse primer GGTAAAGACTCTGTCCATTC; 76E5S311N: forward primer AGTGGAAGTCAAT AAGATTGTCTC, reverse primer GGCATTGACTCTGTACCG. All WT and mutant sequences were confirmed using BLAST (ESI Fig. 11–17† ).
6
Q5 Site-directed Mutagenesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All mutagenesis was carried out using Q5 Site-directed Mutagenesis Kit Protocol (NEB, #E0554S) according to the manufacturer’s instructions using primers in Table 1 . All mutagenesis was confirmed with sequencing (GENEWIZ, South Plainfield, NJ, USA).
7
HeLa T-REx Flp-In Cell Line Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa T‐REx Flp‐In cells were provided by Cell Services, The Francis Crick Institute, and grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% (v/v) foetal bovine serum (FBS). For doxycycline‐inducible overexpression of HMCES variants, the coding sequence of HMCES was amplified from cDNA using Q5 Master Mix (M0544, NEB) before being shuttled into p221 plasmid using BP clonase (11789100, Thermo Fisher). Next, the E127A mutation was introduced with Q5® Site‐Directed Mutagenesis Kit Protocol (E0554, NEB) and both sequences were subcloned into pcDNA5/FRT/TO‐mVenus‐3xFlag‐Gateway (Addgene, #40999) using LR clonase (11791020, Thermo Fisher) before generation of stable cell lines using the T‐REx Flp‐In system (Thermo Fisher) according to manufacturer's instructions. Briefly, HeLa T‐REx Flp‐In cells were grown to 50% confluency in six‐well plates prior to transfection of pOG44 (1.8 μg) and the respective pcDNA5‐FRT/TO plasmids (0.2 μg, containing HMCES‐WT‐mVenus‐3xFlag, HMCES‐E127A‐mVenus‐3xFlag or mVenus‐3xFlag (the gateway recombination cassette was deleted) using Lipofectamine 2000 (Invitrogen). Sixteen hours after transfection, cells were selected in 150 μg/ml hygromycin B (Fisher Scientific)‐containing DMEM media for 10 days.
8
Site-Directed Mutagenesis with Q5 Kit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutagenesis was performed
with the Q5 Site-Directed
Mutagenesis Kit Protocol (New England Biolabs, USA). The protocol
from the supplier was followed. 12.5 μL Q5 Hot Start High-Fidelity
2X Master Mix was mixed with a final concentration of 0.5 μM
forward, 0.5 μM reverse primer (primer sequences given inSupporting Information , Table S1), and 25 ng
template DNA to a final volume of 25 μL. Thermocycling was according
to the following PCR protocol: 98 °C for 10 s, 61 °C for
30 s, 72 °C for 3.5 min. The PCR product was digested with DpnI
and then transformed into XL1-Blue competent cells via heat shock.
with the Q5 Site-Directed
Mutagenesis Kit Protocol (New England Biolabs, USA). The protocol
from the supplier was followed. 12.5 μL Q5 Hot Start High-Fidelity
2X Master Mix was mixed with a final concentration of 0.5 μM
forward, 0.5 μM reverse primer (primer sequences given in
template DNA to a final volume of 25 μL. Thermocycling was according
to the following PCR protocol: 98 °C for 10 s, 61 °C for
30 s, 72 °C for 3.5 min. The PCR product was digested with DpnI
and then transformed into XL1-Blue competent cells via heat shock.
9
SOCS1 Mutant Expression in HEK293T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA from WT human SOCS1 (SOCS1; NM_003745) was subcloned into the mammalian expression vector pCMV-HA-tagged (Clontech). The indicated SOCS1 mutants were generated using the Q5 site-directed mutagenesis kit protocol (NEB). All cDNA sequences were confirmed by Sanger sequencing. Wild-type or mutant SOCS1 plasmids were transfected into HEK293T cells by transient transfection using lipofectamine 2000 (Life Technologies).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!