Each mosquito was homogenized in 300µl of saline buffer. The homogenate was centrifuged at 800g for 2min, and the supernatant was retained. Total DNA was extracted from 100µl of supernatant using the RiboPrep kit (Amplisense, Moscow, Russia) according to the manufacturer's instructions. PCR was carried out in a 25μl volume with an Encyclo Plus PCR kit (Evrogene, Moscow, Russia). The COI gene fragments were amplified using primers 1454F and 2160R and 2027F and 2886R according to the original protocol (25 (link)). The amplification products were sequenced with forward and reverse primers for each primers pair. Sequencing of amplicons was performed using an ABI PRISM 310 sequencer and a BigDye Termination kit as recommended by Applied Biosystems (United States). The sequences were edited manually with Chromas and then aligned using MAFFT v7 (https://mafft.cbrc.jp ). The total length of the COI gene sequences was 1317–1433bp. The nucleotide sequences were deposited in GenBank under accession numbers MZ 501500-MZ501561. Sequences MH817490–MH817558 from our preliminary study (38 ) were also included in the analysis. A total 131 sequences from individual mosquitoes were used for the genetic analysis.
Bigdye termination kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The BigDye Terminator Sequencing Kit is a product offered by Thermo Fisher Scientific for DNA sequencing. It contains the necessary reagents, including fluorescently labeled dideoxynucleotides, required to perform the Sanger sequencing method.
Automatically generated - may contain errors
Lab products found in correlation
Abi prism 3500 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Taq hs perfect mix, by Takara Bio (2 mentions)
Abi 3100 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Chromas, by Technelysium (2 mentions)
Abi prism 310 sequencer, by Thermo Fisher Scientific (1 mentions)
Magmax pathogen rna dna kit, by Thermo Fisher Scientific (1 mentions)
Magmax express 96 deep well magnetic particle processor, by Thermo Fisher Scientific (1 mentions)
3730 sequence analyzer, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Primscript 2 first strand cdna synthesis kit, by Takara Bio (1 mentions)
8 protocols using bigdye termination kit
1
Mosquito DNA Extraction and COI Sequencing
2
Sanger Sequencing to Confirm Variant Inheritance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sanger sequencing was used to confirm that prioritized variants segregated consistently among parents and available family members according to the predicted mode of inheritance. We designed primers targeting TSPEAR exons which harbor the filtered variants of interest using Primer3 tool [47 (link)], Table 1 . PCR was carried out as previously described [48 (link)]. Reactions were sequenced according to manufacturer’s recommendation using the Big Dye Termination kit (Applied Biosystems, Waltham, MA, USA), and ABI Prism 3500 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). Variants were named based on Human Genome Variation Society nomenclature recommendations [49 (link)]. The standards of the American College of Medical Genetics and Genomics (ACMG) were used to classify the level of variant pathogenicity, i.e., pathogenic, likely pathogenic, variant of unknown significance (VUS), benign, or likely benign [50 (link)].
3
Isolation and Sequencing of Avian Influenza Virus RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus’ RNA was extracted from allantoic fluid using an Rneasy Mini kit (Qiagen, Hilden, Germany) and transcribed into cDNA using the Uni12 primer (5′-AGC AAA AGC AGG-3′) and PrimScript™ II 1st Strand cDNA Synthesis Kit (Takara, Japan). The eight segments of the H6 subtype AIVs were then amplified using the universal primers [19 (link)]. The PCR reaction contained 1 μL of cDNA, 1 μL of forward and reverse primers, 12.5 μL of Taq HS Perfect Mix (Takara) and 10.5 μL Rnase-free water, with a final volume of 25 μL. All sequences were confirmed using a BigDye termination kit (Applied Biosystems, Foster City, CA, USA) on an ABI 3730 sequence analyzer.
4
Influenza A Virus Subtyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNAs were extracted directly from samples using the MagMAX Pathogen RNA/DNA Kit (Applied Biosystems, Foster City, CA) on a MagMAX Express-96 Deep Well Magnetic Particle Processor (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. Real-time reverse-transcription PCR (qRT-PCR ) using matrix gene primers and probe was used to detect influenza A viruses, and then positive samples were transcribed into cDNA using the Unit12 primer and PrimScript TMII 1st Strand cDNA Synthesis Kit (Takara, Tokyo, Japan). Hemagglutinin and neuraminidase were determined using universal primers (Huang et al., 2013 (link); Kim et al., 2019 (link)). The full-length 8 segments of H4N2 were amplified using the universal primers (Hoffmann et al., 2001 (link)). All sequences were confirmed with the BigDye termination kit (Applied Biosystems, Foster City, CA) on an ABI 3730 sequence analyzer.
5
Genetic Analysis of DVL2 and SMOC2 Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed using Primer3 [81 (link)]. Primers to amplify the DVL2 mutation produced a 297 base pair product (Forward Primer: CGGCTAGCTGTCAGTTCTGG; Reverse Primer: CAGTGAGTCTGAGCCCTCCA). PCR products were sequenced using the Big Dye termination kit on an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Segregation analysis was evaluated by Fisher’s exact test. Sequences were evaluated using Chromas (Technelysium, South Brisbane, QLD, Australia). The sequences were aligned to the Boxer dog reference sequence (CanFam 3.1) using BLAT (UCSC Genome Browser). Primers described by Marchant et al. [29 (link)] were used to evaluate the SMOC2 mutation status for 152 dogs. PCR products sizes were visualized via gel electrophoresis.
6
Validating VPS11 Functional Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed using Primer3 (Rozen and Skaletsky 2000 (link)) to validate the putative functional mutation uncovered in VPS11 (F: CTGCAGGTCCCTGTCCTAAG; R: TGTACCTGGCTCTTGGCTCT). PCR products were sequenced using the Big Dye termination kit on an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Sequences were evaluated using Chromas (Technelysium, South Brisbane, QLD, Australia). Sequences were aligned to CanFam3.1 using BLAT (UCSC Genome Browser). Allele frequency was calculated excluding the seven affected cases.
7
Sanger Sequencing for Variant Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sanger sequencing was used for segregation analyses among affected siblings, parents, and available family members of molecularly characterized patients. Primers were designed using Primer3 tool (https://primer3.ut.ee/ , accessed on 10 January 2021), Table 1 . PCR cycling conditions started by initial denaturation at 96 °C for 5 min followed by 30 three-stage cycles. Each cycle included (1) denaturation at 96 °C for 30 s, (2) annealing at primer pair’s specific temperature for 30 s, and (3) extension at 72 °C for 30 min. A final extension at 72 °C for 5 min followed. PCR products were purified using QIAquick PCR purification kit (Qiagen, Dusseldorf, Germany). Forward and reverse DNA strands were sequenced using the Big Dye Termination kit (Applied Biosystems, Waltham, MA, USA), and analyzed on the ABI Prism 3500 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA) according to manufacturer’s protocols.
8
Influenza A Virus Genomic RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNAs were extracted from allantoic fluids using an RNeasy Mini kit (Qiagen, Hilden, Germany) and transcribed into cDNAs using the Uni12 primer (5′-AGC AAA AGC AGG-3′) and PrimScript II first Strand cDNA Synthesis Kit (Takara, Japan). The 8 segments of the H7 subtype AIV genomic RNA were amplified using universal primers. Each PCR reaction contained 1 μL of cDNA, 1 μL each of forward and reverse primers, 12.5 μL of Taq HS Perfect Mix (Takara, Mountain View, CA), and 10.5 μL of Rnase-free water in a final volume of 25 μL. PCR products were sequenced using a BigDye termination kit (Applied Biosystems, Foster City, CA) on an ABI 3730 sequence analyzer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!