The ArlR knockout and site-directed mutagenesis strains were generated using the protocol described previously (34 (link)). For the quantitative PCR experiments, 500 ul of ArlR knockout and site-directed mutant strains from overnight pre-culture were grown in 50 ml of TSB (17 g/l tryptone, 3 g/l soya peptone, 2.5 g/l d -glucose, 5 g/l NaCl, 2.5 g/l K2HPO4, pH 7.3) at 37°C for 12 h. Total RNA was isolated from planktonic cells using a Qiagen RNeasy Mini kit, RNA purity was checked by the Abs260/Abs280 ratio of 2.0 to 2.1. First-strand cDNA synthesis from total RNA was performed with the High-Capacity cDNA Reverse Transcription Kit (Bio-Rad) using 300 ng of total RNA as the template following the manufacturer's instructions. Expression of icaA was determined by two-step real-time PCR using the Power SYBR Green PCR Master Mix (Bio-Rad) and Real-Time PCR System (Bio-Rad). Primers were annealed at 60°C, and the 16S-RNA was used as reference to normalize all data. The specificity of all qRT-PCR primers (Supplementary Table S1 ) was verified using normal PCR. Fold changes in various icaA transcripts in ArlR knock out and mutant strains in relative to pLi50-ArlR were calculated using the 2−ΔΔCt formula (35 (link)).
Power sybr green pcr master mix
Manufactured by Bio-Rad
Sourced in United States
Power SYBR Green PCR Master Mix is a ready-to-use solution for real-time PCR amplification and detection using SYBR Green I dye. It contains all the necessary components, including SYBR Green I, DNA polymerase, dNTPs, and buffer, to perform real-time PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (12 mentions)
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Universal master mix, by Thermo Fisher Scientific (4 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (4 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Oligo dt primer, by Roche (3 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Step 1 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Cfx96 real time system, by Bio-Rad (3 mentions)
Oligo dt primer, by Thermo Fisher Scientific (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Touch real time pcr system, by Bio-Rad (3 mentions)
Myiq2 themocycler, by Bio-Rad (2 mentions)
Cfx96 thermal cycler, by Bio-Rad (2 mentions)
M mlv reverse transcriptase, by Promega (2 mentions)
Ncode mirna first strand complementary dna synthesis kits, by Thermo Fisher Scientific (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
Cfx96 instrument, by Bio-Rad (2 mentions)
61 protocols using power sybr green pcr master mix
1
Quantitative PCR Analysis of icaA Expression
2
Quantitative PCR for Nr1h4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR was carried out with Power SYBR Green PCR Master Mix (Bio-Rad, Hercules, California) using a QuantStudio 5 real-time PCR system (Applied Biosystems, Foster City, California) as described previously [17 (link)]. Briefly, intestinal tissue was homogenized in TRIzol, and total RNA was isolated according to the manufacturer’s instructions. Expression was normalized to cychlophilin B (Ppib). Primer sequences were as follows: nuclear receptor subfamily 1 group H member 4 (Nr1h4), forward: TACCACTACAACGCGCTCAC, reverse: GGCGTTCTTGGTAATGCTTC; Ppib, forward: TCCATCGTGTCATCAAGGACTT, reverse: CTCATCTGGGAAGCGCTCA.
3
Quantification of mRNA Levels by Real-Time PCR
4
qRT-PCR Analysis of Ccl2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell mRNAs were extracted in TRIzol (Invitrogen), and reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Target cDNAs were amplified with Power SYBR Green PCR Master Mix (Bio-Rad) and real time cycle thresholds were detected via MyiQ2 themocycler running on an iQ5 software (Bio-Rad). Target genes fold induction were calculated using the 2−ΔΔCt method by normalizing cycle thresholds to the Hprt housekeeping gene and medium controls (Livak and Schmittgen, 2001 (link)). Verified Ccl2 primer sequences were acquired from the PrimerBank (Harvard Medical School, Massachusetts General Hospital and The Center for Computational and Integrative Biology), and commercially synthesized (Integrated DNA Technologies). Ccl2 forward primer sequence (5′ to 3′): TTAAAAACCTGGATCGGAACCAA, and reverse primer sequence (5′ to 3′): GCATTAGCTTCAGATTTACGGGT.
5
mRNA Expression Quantification Using RT-qPCR
6
Quantification of miRNA Expression in Liver Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from liver tissue or culture cells after infection or transfection of control, miRNA‐143 and miRNA inhibitors by TRIzol reagent (Life Technologies) according to the manufacturer's protocol. Total microRNA was extracted from liver tissue or culture cells using a miRcute miRNA isolation kit (TIANGEN BIOTECH (BEIJING) as described by the manufacturer. Subsequently, total RNA was reverse‐transcribed to cDNA using a RevertAid First Strand cDNA Kit (Thermo Fisher). The products were subjected to real‐time PCR analysis using a CFX96™ Real‐time System (Bio‐Rad) with a Power Sybr Green PCR Master Mix (Bio‐Rad). Primers for gene amplification were synthesized and obtained from GENTEC. Sequences of primers are presented in Table S1 . The mRNA data were normalized to β‐actin housekeeping gene. RT‐qPCR assay was performed in duplicate.
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 4-ml volume of the overnight culture was harvested via centrifugation at 13,523 × g for 1 min. Total RNA was extracted with an RNA extraction kit according to the instructions of the manufacturer (CoWin Biosciences). RNA (1 μg) was reverse transcribed into cDNA with random primers with a ReverTra-Plus kit from Toyobo (Shanghai, China). The product was quantified via real-time PCR using a CFX96 thermal cycler (Bio-Rad). The reaction mixture (20 μl) contained Power SYBR green PCR master mix (Bio-Rad) and 0.4 μM gene-specific -F(RT)/-R(RT) primer series as shown in Table S1 . The PCR parameters were one cycle of 95°C for 2 min followed by 40 cycles of 95°C for 20 s, 55°C for 20 s, and 72°C for 15 s. The rpoB housekeeping gene was used as a reference to normalize the relative amounts of mRNA, and ATCC 19606 was used to normalize the transcriptional level of each strain (34 (link)).
8
Cardiac RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from myocardial tissue using a commercial RNA isolation kit (Qiagen, Germany). 3.6 μg of RNA was reverse transcribed into cDNA using superscript® III first-strand synthesis system (Invitrogen, USA) according to the manufacturer's instructions. Real-time PCR was performed using Power SYBR Green PCR master mix (Bio-Rad, USA). Data were normalized to GAPDH gene expression, and calculated using the comparative quantification method (2-ΔΔCt). Primers for amplifying rat genes were as follows:
GAPDH forward primer, 5'-ACAGCAACAGGGTGGTGGAC-3' and reverse primer, 5'-TTTGAGGGTGCAGCGAACTT-3';
PCAF forward primer, 5'-TTTCTGTCAGCACATTCGGC-3' and reverse primer, 5'-GGGTTTTGTGTTTCGGGTCA -3'.
GAPDH forward primer, 5'-ACAGCAACAGGGTGGTGGAC-3' and reverse primer, 5'-TTTGAGGGTGCAGCGAACTT-3';
PCAF forward primer, 5'-TTTCTGTCAGCACATTCGGC-3' and reverse primer, 5'-GGGTTTTGTGTTTCGGGTCA -3'.
9
Quantitative PCR Assay for Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRI-reagent solution (Sigma) and treated with DNase (Invitrogen, ThermoFisher Scientific). Reverse transcription was performed using random hexanucleotides as primers and highscript reverse transcriptase (Bio-Rad, Hercules, CA, USA) according to standard procedures. Quantitative (q) PCR was carried out using the power SYBR Green PCR Master Mix (Bio-Rad), according to manufacturer’s instructions. Primers specific for rat G6pd were used for normalization of the data. Primer sequences were as follows: rat Pou5f1 (5′-CCTGCAGCAGATCACTAGCAT-3′ / 5′-CACTCGAACCACATCCCTCT-3′); rat Sox2 (5′-ACCGTGATGCCGACTAGAAA-3′ / 5′-GCGCCTAACGTACCACTAGAA-3′); rat Nanog (5′-GTCTGCTACTGAGATGCTCT-3′ / 5′-ATCTGCTGGAGGCTGAGGTA-3′); rat G6pd (5′-TCCTCTATGTGGAGAATGAACG-3′ / 5′-TCATTCAGAGCTTTGCCACA-3′); rat Patz1 all variants (5′-CCAGAGCTGTGGGAAAGG-3′ / 5′-TGCACCTGCTTGATATGTCC-3′); rat Cdh1 (5′-CCTGGGACTCCAGTTACAGG-3′ / 5′-CTC.AGACCCTGTGAAAGCTGG-3′); rat Vim (5′-GAATACCGGAGACAGGTGCAG-3′ / 5′-CGGCCAATAGTGTCCTGGTAG-3′).
10
Isolation and Quantification of miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The isolated livers were used for total RNA isolation using Trizol (Invitrogen; Auckland, New Zealand) according to the manufacturer’s instructions and reverse-transcribed into cDNA with the Reverse Transcriptase M-MLV (Promega, Madison, WI, United States).
Primer sequences to be used in the experiment were as follows:
Small RNA species-enriched RNA was isolated based on the manufacturer’s instructions (mirVana miRNA isolation kit; Ambion, Austin, TX, United States) for miRNA quantitative reverse transcriptase PCR. miRNA was reverse-transcribed by using Ncode miRNA first-strand complementary DNA synthesis kits (Invitrogen). Quantitative reverse transcriptase PCR was accomplished using a Power SYBR Green PCR Master Mix on a CFX96 Instrument (Bio-Rad, United States). The relative standard curve method was used for data analysis.
Primer sequences to be used in the experiment were as follows:
Small RNA species-enriched RNA was isolated based on the manufacturer’s instructions (mirVana miRNA isolation kit; Ambion, Austin, TX, United States) for miRNA quantitative reverse transcriptase PCR. miRNA was reverse-transcribed by using Ncode miRNA first-strand complementary DNA synthesis kits (Invitrogen). Quantitative reverse transcriptase PCR was accomplished using a Power SYBR Green PCR Master Mix on a CFX96 Instrument (Bio-Rad, United States). The relative standard curve method was used for data analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!