Iq5 real time pcr detection system

Total RNA was extracted from treated grapevine leaf and all tissues as described above. To generate first-strand cDNA, 0.5 μg of DNase I-treated total RNA was reverse transcribed in 10 μL volume using PrimeScript Reverse Transcriptase Kit according to the manufacturer’s instructions (TaKaRa, Dalian, China). Subsequently, qRT-PCR was performed on a Bio-Rad IQ⁵ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) using SYBR Premix Ex Taq II, according to the manufacturer’s instructions (TaKaRa, Dalian, China). Primers used for qRT-PCR are listed in Additional file 1: Table S1. PCR reactions were prepared in 96-well plates (Bio-Rad, USA), and each reaction contained 1 μL of diluted cDNA (100 ng/μL), 12.5 μL of SYBR Green PCR Master Mix, 1 μL of each primer (at 250 nM) in a final volume of 25 μL. The qRT-PCR was performed using the following conditions: initial denaturation at 94 °C for 3 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s, and lastly melting curve analysis at 60–94 °C. The VdGAPDH gene was used as a reference gene for data normalization according to the 2^-ΔΔc(t) method [36 (link)]. All reactions were conducted in three technical replicates. Mean values of three independent experiments were analyzed using the Student’s t-test.

Total RNA was isolated from spheroids using a RNeasy mini kit (Qiagen). RNA was reverse-transcribed into cDNA using ReverTra Ace^® qPCR RT Master Mix (Toyobo) according to the manufacturer‘s in structions. qRT-PCR was performed on a Bio-Rad iQ5 Real-Time PCR detection system (Bio-Rad) with SYBR green master mix (Toyobo). Target gene expression levels were normalized to housekeeping gene β-actin by the 2 ^ ^−ΔΔCt method. The primers used in this study are listed in Supplementary Table S4.

Tissues or cells were lysed in the Qiagen RLT lysis buffer (Qiagen, USA). RNA was extracted with an RNeasy mini kit (Qiagen, USA) and reverse transcribed by M-MLV reverse transcriptase (Invitrogen, USA). Quantitative real-time PCR was performed on a Bio-Rad iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, USA) with a SYBR Green I Master Mix (TAKARA, Japan). PCRs were performed in triplicate, and the relative gene expression was calculated against GAPDH. Primer pairs used in this study were as follows: GAPDH: F, 5′-GAAGGTGAAGGTCGGAGT-3′/R, 5′-GAAGATGGTGATGGGATTTC-3′; LPA₁: F, 5′-AATCGAGAGGCACATTACGG-3′/R, 5′-GTTGAAAATGGCCCAGAAGA-3′; LPA₂: F, 5′-TTGTCTTCCTGCTCATGGTG-3′/R, 5′-TCAGCATCTCGGCAAGAGTA-3′; LPA₃: F, 5′-TGCTCATTTTGCTTGTCTGG-3′/R, 5′-GCCATACATGTCCTCGTCCT-3′.

The mRNA expression levels of MEIS2 and its associated‐genes were quantified using real‐time polymerase chain reaction (qRT‐PCR) analyses. Briefly, Qiagen RNeasy Mini Kit (Qiagen) was used to purify total RNA from cells according to the manufacturer's protocol. The reverse transcription was conducted with high‐capacity cDNA Reverse Transcription Kit (Thermo Fisher) to obtain cDNA from the extracted RNA. SYBR Green qPCR Supermix (Solis BioDyne) was used for the real‐time PCR according to the manufacturer's protocol on BIO‐RAD iQ5 real‐time PCR Detection System (BIO‐RAD). The mRNA levels of MEIS2 and its potentially regulating genes were normalized to the housekeeper gene GAPDH. Graphpad Prism 5 software was applied to perform Two‐tailed and unpaired t‐tests. The sequences of primers used for real‐time PCR were as following: MEIS2‐F: GAAAAGGTCCACGAACTGTGC, MEIS2‐R: CTTTCATCAATGACGAGGTCGAT; IL10‐F: GACTTTAAGGGTTA CCTGGGTTG, IL10‐R: TCACATGCGCCTTGATGTCTG;GAPDH‐F: AAGGT GAAGGTCGGAGTCAAC, GAPDH‐R: GGGGTCATTGATGGCAACA ATA.