The total RNA of hESCs, hEECs, and DSCs was extracted by TRIzol regent (Trizol, TaKaRa, Japan). Subsequently, the NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, MA, USA) was used to quantify the concentration and purity of RNA. The PrimeScript RT Reagent Kit (TaKaRa, Japan) was utilized to reversely transcribe total RNA to cDNA. Next, qRT-qPCR was performed with SYBR Green PCR Master Mix (Yeasen Biotechnology Co., Ltd., Shanghai, China). The qRT-PCR primers are listed in Additional file 24 : Table S1. The target mRNA expressions were normalized to ACTB expression. All reactions were processed on the Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific). The test results were analyzed using the 2−ΔΔCt method.
Sybr green pcr master mix
Manufactured by Yeasen
Sourced in China, United States
SYBR Green PCR Master Mix is a ready-to-use solution that contains all the necessary components for performing real-time PCR amplification, including SYBR Green I dye, DNA polymerase, dNTPs, and buffer. It is designed to simplify the setup of real-time PCR reactions and provide consistent and reliable results.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (16 mentions)
Sybr assay 1 low rox, by Eurogentec (10 mentions)
Trizol reagent, by Takara Bio (6 mentions)
Rnaiso plus reagent, by Takara Bio (6 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Trizol reagent, by Beyotime (4 mentions)
4xhifair 3 supermix plus, by Yeasen (3 mentions)
Reverse transcription kit, by Takara Bio (3 mentions)
Quantstudio 3, by Thermo Fisher Scientific (3 mentions)
Hifair 3 1st strand cdna synthesis supermix, by Yeasen (3 mentions)
Ez 10 dnaaway rna mini preps kit, by Sangon (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Hiscript 2, by Vazyme (2 mentions)
Trizol reagent, by Merck Group (2 mentions)
7500 real time pcr system, by Yeasen (2 mentions)
Hiscript 2 one step rt pcr kit, by Vazyme (2 mentions)
Mirna reverse transcription kit, by Takara Bio (2 mentions)
Trizon reagent, by CWBIO (2 mentions)
Total rna kit 1, by Omega Bio-Tek (2 mentions)
76 protocols using sybr green pcr master mix
1
Quantification of hESC, hEEC, and DSC RNA
2
RNA Extraction and qRT-PCR Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by Trizol reagent (Life), and genomic DNA was removed with 5 × g DNA digester (Yeasen) with the reaction carried out at 42 ℃ for 2 min, and then adding 4xHifair® III SuperMix plus (Yeasen) at 37 ℃ for 15 min and 85 ℃ for 5 s for reverse transcription to synthesize cDNA. qRT-PCR was performed using a Roche instrument and a SYBR Green PCR master mix(Yeasen) with the following steps:95 ℃ for 5 min, 35 cycles at 95 ℃ for 30 s, 58 ℃ for 30 s, 72 ℃ for 30 s, ACTIN was used as an internal control. The primer sequences are shown in Additional file 2 : Table S1.
3
Validating RNA-seq Data by RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the RNA-seq results, the total RNA used for RNA-seq was also reverse-transcribed into cDNA with Hifair® II 1st Strand cDNA Synthesis SuperMix (YEASEN, CA, United States). Different expression genes were selected and verified by RT-qPCR using SYBR Green PCR Master Mix (YEASEN, CA, United States) and the Bio-Rad CFX384 PCR detection system. The relative mRNA level of each target gene was evaluated against soybean elongation factor 1-beta (GmELF1b) (Glyma.02G276600). The primers were shown in Supplementary Table 4 . Three technical replicates were performed and the relative levels of transcript abundance were calculated using the 2–ΔΔCT method.
4
Quantifying LOXL1-AS1 Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by using TRIzol reagent (Invitrogen, Thermo Fisher Scienti c, Inc.). The quantity of total RNA was measured by using NanoDrop equipment (Thermo Fisher Scienti c, Waltham, Massachusetts, USA) according to the manufacturer's instructions.
Complementary DNA (cDNA) was synthesized using a cDNA synthesis kit (Yeasen, Shanghai, China). qPCR was performed using the SYBR Green PCR Master Mix (Yeasen, Shanghai, China). All target genes were normalized to the endogenous reference gene GAPDH by using an optimized comparative Ct (2-ΔΔCt) value method. qPCR assay was performed on the 7500 Fast qPCR system using a One-Step SYBR PrimeScript RT-PCR kit (Applied Biosystems, Foster City, California, USA). The speci c primer sequences of LOXL1-AS1 and GAPDH were as follows: LOXL1-AS1 forward primer: GGTGCCACGGCTTACCAA LOXL1-AS1 reverse primer: TCCTATCCCTGCCATTCCCA GAPDH forward primer: GAAGGTGAAGGTCGGAGTC GAPDH reverse primer: GAAGATGGTGATGGGATTTC
The relative gene expression was quanti ed using the 2-ΔΔCtmethod.
Complementary DNA (cDNA) was synthesized using a cDNA synthesis kit (Yeasen, Shanghai, China). qPCR was performed using the SYBR Green PCR Master Mix (Yeasen, Shanghai, China). All target genes were normalized to the endogenous reference gene GAPDH by using an optimized comparative Ct (2-ΔΔCt) value method. qPCR assay was performed on the 7500 Fast qPCR system using a One-Step SYBR PrimeScript RT-PCR kit (Applied Biosystems, Foster City, California, USA). The speci c primer sequences of LOXL1-AS1 and GAPDH were as follows: LOXL1-AS1 forward primer: GGTGCCACGGCTTACCAA LOXL1-AS1 reverse primer: TCCTATCCCTGCCATTCCCA GAPDH forward primer: GAAGGTGAAGGTCGGAGTC GAPDH reverse primer: GAAGATGGTGATGGGATTTC
The relative gene expression was quanti ed using the 2-ΔΔCtmethod.
5
Hippocampal Gene Expression in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was conducted to measure the expression of differentially expressed mRNA. The 12 mice were randomly divided into 4 groups, and the modeling mentioned above was employed to administer different stimuli to each group. Immediately after the stimulation, the mice were euthanized to obtain hippocampal tissue. Hippocampal RNA was extracted using a TSINGKE TSP413 RNAprep FastPure kit (Beijing Tsingke Biotechnology Co., Ltd.). Target genes were reverse transcribed and amplified using MightyScript First Strand cDNA Synthesis Master Mix (Sangon, Shanghai, China) according to the manufacturer’s instructions. Quantitative real-time PCR was performed with the LightCycler 480 (Roche, Rotkreuz, Switzerland) and SYBR Green PCR master mix (Yeasen, Shanghai, China). The fold change in the gene expression was calculated using the comparative Ct method, and three replicates were tested for each cDNA sample. The following primers were used (synthesized by Tsingke Biotechnology Co.): Slc17a6; 5′- GTCGGTAAAACAAAGGATTTTGGC -3′ (forward), 5′- GCTTCTTCTCCAGCACCCTGTA -3′ (reverse) and β-actin; 5′-AACAGTCCGCCTAGAAGCAC-3′ (forward), 5′-CGTTGACATCCGTAAAGACC-3′ (reverse). Gene expression levels were normalized to those of β-actin as an endogenous control. Each experiment was repeated at least three times.
6
Validation of Upregulated tRFs/tiRNAs by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tsRNAs chosen for validation by RT‐qPCR were selected based on the following criteria: tsRNAs with exact match of alignment information, FC>1.5, P‐value < .05 and expression detected in all samples, indicating that the tag count for each sample was over zero. Based on these criteria, six up‐regulated tRFs/tiRNAs of tRF‐1:28‐Gly‐GCC‐4, tRF‐1: tRF‐1:31‐Glu‐TTC‐2, tRF‐1:16‐Gly‐GCC‐1, tRF‐+1:T23‐Arg‐TCG‐1, tRF‐53:71‐chrM. Gly‐TCC and tRF‐51:71‐chrM were chosen for RT‐qPCR. The cDNA was synthesized using the reverse transcription kit (Takara), and SYBR Green PCR Master Mix (Yeasen Biotechnology) was selected for RT‐qPCR accomplishment. The tRNA expression was normalized with U6 (Takara). Fold changes in tsRNAs expression were calculated using the 2−ΔΔCt method for each sample in triplicate. ΔΔCt = [(Ct tRNA‐Ct U6) diseased ‐ (Ct tRNA‐Ct U6) control]. The primers used to amplify the tRF transcripts are presented in Table S1 .
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qPCR) was performed to measure the mRNA levels of target genes. Total mRNA was isolated from cultured cells with TRIzol Reagent (AM9738; ThermoFisher Scientific). cDNA was synthesized via reverse transcription of RNA with a Transcriptor First Strand cDNA Synthesis Kit (AM9738; Thermo Fisher Scientific). qPCR was performed on a CFX96 TouchTM Real-Time PCR Detection System using SYBR Green PCR Master Mix (11201ES08, Yeasen) in accordance with the manufacturer's instructions. The relative expression levels of the target genes were calculated and normalized to the loading control 18S rRNA. All the primers used in this study are listed in Supporting Information Table S2 .
8
Comprehensive RT-PCR and RNA-seq Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RT-PCR, total RNA was isolated from cells with RNA Isolater Total RNA Extraction Reagent (Vazyme Biotech) according to the manufacturer’s instructions. The isolated RNA was reverse transcribed into complementary DNA using HiScript II (Vazyme Biotech). Quantitative real-time PCR was performed with a CFX96 Real-Time system (Bio-Rad) and SYBR Green PCR master mix (Yeasen). The fold change in the gene expression was calculated using the comparative Ct method, and three replicates were tested for each complementary DNA sample. ACTB or Actb were used as an internal reference. Primers used in this study were as follows:
hCTGF forward: 5′-AAAAGTGCATCCGTACTCCCA-3′,
hCTGF reverse: 5′-CCGTCGGTACATACTCCACAG-3′;
hCYR61 forward: 5′-GGTCAAAGTTACCGGGCAGT-3′,
hCYR61 reverse: 5′-GGAGGCATCGAATCCCAGC-3′;
hACTB forward: 5′-ATCATGAAGTGTGACGTGGA-3′;
hACTB reverse: 5′-CTCAGGAGGAGCAATGATCT-3′.
For RNA-seq, HGC-27 cells in 6-well plates were treated with DSF, TH, or CX. Total RNA was extracted. RNA quality was assessed using a 2100 Expert Bioanalyzer (Agilent) and sent for library preparation and sequencing using the Illumina Hiseq2000 platform of Majorbio Biotech. The data were analyzed on the free online Majorbio I-Sanger Cloud Platform (www.majorbio.com ). The GEO accession numbers for the high-throughput sequencing reported in this paper is GSE168618 .
hCTGF forward: 5′-AAAAGTGCATCCGTACTCCCA-3′,
hCTGF reverse: 5′-CCGTCGGTACATACTCCACAG-3′;
hCYR61 forward: 5′-GGTCAAAGTTACCGGGCAGT-3′,
hCYR61 reverse: 5′-GGAGGCATCGAATCCCAGC-3′;
hACTB forward: 5′-ATCATGAAGTGTGACGTGGA-3′;
hACTB reverse: 5′-CTCAGGAGGAGCAATGATCT-3′.
For RNA-seq, HGC-27 cells in 6-well plates were treated with DSF, TH, or CX. Total RNA was extracted. RNA quality was assessed using a 2100 Expert Bioanalyzer (Agilent) and sent for library preparation and sequencing using the Illumina Hiseq2000 platform of Majorbio Biotech. The data were analyzed on the free online Majorbio I-Sanger Cloud Platform (
9
Quantitative Real-Time PCR Analysis of LPS-Induced Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Raw264.7 cells were cultured in DMEM media (5% CSS) and then cultured in 6‐well plates (1 × 106 cells per well). After overnight incubation, the media was removed and the cells were treated with 20 ng mL−1 LPS and 10 µm indicated compounds. After 18 h incubation, the total RNA was extracted using the EZ‐10 DNAaway RNA Mini‐Preps Kit according to the manufacturer's instructions (Sangon Biotech, Shanghai, China). Hifair III 1st Strand cDNA Synthesis SuperMix (YEASEN, Shanghai, China) was used to generate cDNA. Quantitative real‐time polymerase chain reactions were performed using the SYBR Green PCR Master Mix (YEASEN, Shanghai, China) kit and 0.4 µm indicated primers. Analysis of mRNA expression was performed using the Applied Biosystems QuantStudio 3. GAPDH was used as an internal control and the relative mRNA levels were analyzed by the 2−∆∆Ct method. Primers used for the Q‐RT PCR analyses are following:
COX‐2 F: 5′‐TTCAAAAGAAGTGCTGGAAAAGGT‐3′
COX‐2 R: 5′‐GATCATCTCTACCTGAGTGTCTTT‐3′
GILZ F: 5′‐GCTGCACAATTTCTCCACCT‐3′
GILZ R: 5′‐GCTCACGAATCTGCTCCTTT‐3′
GAPDH F: 5′‐AGGCCGGTGCTGAGTATGTC‐3′
GAPDH R: 5′‐GCAGTTGGTGGTGCAGGATG‐3′
COX‐2 F: 5′‐TTCAAAAGAAGTGCTGGAAAAGGT‐3′
COX‐2 R: 5′‐GATCATCTCTACCTGAGTGTCTTT‐3′
GILZ F: 5′‐GCTGCACAATTTCTCCACCT‐3′
GILZ R: 5′‐GCTCACGAATCTGCTCCTTT‐3′
GAPDH F: 5′‐AGGCCGGTGCTGAGTATGTC‐3′
GAPDH R: 5′‐GCAGTTGGTGGTGCAGGATG‐3′
10
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA of aortic tissues and HUVECs were extracted using TRIzol reagent (Sigma, St. Louis, MO, USA), following the manufacturer's protocols. Subsequently, 1 µg RNA was reverse‐transcribed into cDNA using the Mir‐X miRNA First‐Strand Synthesis Kit or PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China), respectively. Then, SYBR Green PCR Master Mix (Yeasen, Shanghai, China) was used to perform qRT‐PCR. Table S2 lists the PCR primers used in the experiment, which were purchased from TsingKe (Beijing, China). U6 was considered as internal reference of miRNA, and GAPDH was an housekeeping gene to other target genes. The relative gene expression was analysed using the 2−△△Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!