Revertra ace kit

RNA isolation, reverse transcription, and qPCR were performed as previously described (Lu et al., 2017 (link), 2021 (link)). Briefly, RNA was isolated with TRIzol reagent and reverse transcribed (1 μg) using the ReverTra Ace Kit (TOYOBO, Nipro, Osaka, Japan). The resulting cDNA was used as a template for qPCR which was performed in a LightCycler 480 system (Roche) using a 2 × Power SYBR Green Mix (Applied Biosystems, Carlsbad, CA, USA). Gene expression levels were normalized to that of GAPDH and calculated using the 2^–ΔΔCt method. The sequences of the primer used for qPCR are available on request from the corresponding authors.

Eight cone opsin genes, LWS-A/LWS-B, RH2-A, RH2-B, RH2-C, SWS1, SWS2-A, and SWS2-B, have been reported in medaka^{30 (link)}. The expression of opsin genes in the eyes of newly hatched embryo medaka (3 days post-hatching, dph) of the Hd-rRII1 inbred strain was analyzed by RT-PCR. Each opsin gene primer was from Matsumoto et al.^{30 (link)} and Chinen et al.^{48 (link)}. LWS-A and LWS-B genes were highly similar coding^{30 (link),49 (link)}. Therefore, we used only LWS-A primer set. The total RNA was extracted from the eyes after homogenization in a 1.5-ml tube with 1000-μl Tri Reagent (Cosmo Bio Co., Ltd. Japan) following the manufacturer’s instructions. A ReverTra Ace kit (ReverTra Ace qPCR RT Master Mix with gDNA Remover; Toyobo Co., Ltd. Japan) was used for cDNA synthesis, and BIOTAQ DNA polymerase (Bioline Ltd. United Kingdom) was used for RT-PCR. PCR conditions were as follows: 95 °C for 30 sec, then 40 cycles of 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 1 min, and 80 °C for 8 sec.

Total RNA was isolated from the NHDFs using the FastGene™ RNA Basic Kit (Fast Gene, Japan) according to the manufacturer’s protocol. Single strand cDNA was generated from 0.1 μg of total RNA using the Rever Tra Ace kit (Toyobo, Osaka, Japan) according to the manufacturer’s protocol. Quantitative polymerase chain reaction (RT-PCR) analysis was performed using the Applied Biosystems Step One system (Applied Biosystems, Foster City, CA, USA) with the THUNDERBIRD SYBR qPCR Mix (Toyobo) according to the manufacturer’s protocols. The primers used are shown in Table 1. The following RT-PCR protocol was employed: initial activation step at 95°C for 1 min followed by 40 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 1 min. All RT-PCR experiments were performed in duplicate. The accuracy of each reaction was confirmed from the difference in Ct value of the duplicates.
To consider the specificity of the primer set for SMA, a set of primers which has been designed to selectively detect the human SMA was used [39 (link)]. The primers for other genes were originally designed by using the Primer-BLAST tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/).

The full-length GH 11 xylanase gene, xyn11B, was identified from the genome sequence of H. insolens Y1 (whole genome sequencing in progress). The PCR product was ligated into the pGEM-T Easy vector and transformed into Escherichia coli cells for sequencing. The total RNA was extracted from the mycelia after 3 days' growth on wheat bran medium [12 (link)] by using the Promega SV Total RNA Isolation System according to the manufacturer's instructions. To obtain the cDNA of the gene xyn11B, the first-strand cDNA was synthesized using a ReverTra Ace kit (Toyobo, Japan). The cDNA sequence encoding mature Xyn11B without the signal peptide-coding sequence was amplified using two expression primer sets (xyn11B-PF: GAATTCGCCCCCGGTGAGCTGCCTGGCATGC and xyn11B-PR: GCGGCCGCTTACAGGCACTGAGAGTACCACTGG, restriction sites underlined). The PCR products with appropriate size were ligated into the pGEM-T Easy vector for sequencing.

To confirm the reliability of the data obtained using Illumina sequencing, 15 circRNAs were randomly selected for PCR confirmation. Two sets of primers (divergent and convergent) were designed by Primer Premier 5 software for each selected circRNA (Table S5). In general, the divergent primers were designed near both side sequences of circRNA junctions, and the products’ length ranged from 80 to 150 bp, whereas the convergent primers were the traditional primers for RT-qPCR. The divergent primers were expected to amplify only circRNAs, while the convergent primers could amplify both circRNAs and linear forms. Total RNA was extracted, digested using RNase-Free DNase (Promega) and RNase R (Epicentre), and then purified. A total of 2 µg purified RNA was used to prepare first-strand cDNA by using a random hexamer primer and the ReverTra Ace Kit (Toyobo, Osaka, Japan). Grass carp cDNAs or genomic DNA (20 ng) were used as template for PCR amplification with KOD-Plus-Neo DNA polymerase (Toyobo), and more than 35 cycles were performed. To confirm the PCR results, PCR products of the expected length were subjected to Sanger sequencing by Tsingke Company (Tsingke, Beijing, China).

Peritoneal macrophages cultured in the 12-well plate were washed once with ice-cold PBS, and total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Obtained RNA was reverse-transcribed into cDNA using the ReverTra Ace kit (Toyobo, Osaka, Japan). The real-time quantitative PCR (qPCR) assay was performed using the KAPA SYBR FAST Universal qPCR Kit (Kapa Biosystems, Boston, MA, USA) and StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). RNA extraction, cDNA synthesis, and qPCR assay were performed according to the manufacturer's protocols. The relative levels of gene expression were calculated using the delta-delta Ct method. Rpl19 was used as an endogenous control. Primer sequences are listed in Supplementary Table 1.