Magna chip a kit

OVCAR8, MDA-MB-231, SKOv3, OVCAR8-SIK2 KO, or SKOv3-SIK2 KO cells (2 million) were cultured on a 150 cm plate and treated the next day either with vehicle control or with ARN3236 (4 μM) or ARN3261 (5 μM) for 48 hours. ChIP assays were performed using the Magna ChIP A kit (MilliporeSigma, 17-610). Detailed procedures and analysis are included in Supplemental Methods. Purified and enriched DNA was quantified using RT-qPCR with the following primers: FANCD2 forward, 5′ CGTGAAGTCTGGCTTAGGATTAG 3′ and reverse, 5′ CCCTTCTTCAATACTTCCCTACC 3′; EXO1 forward, 5′ GGTCTGGCCTAAGGTTTCTTC 3′ and reverse, 5′ CAGTTCACGCTGGGTTCTT 3′; and XRCC4 forward, 5′ GCAGTCTTCCTAGTCTCAACTG 3′ and reverse, 5′ TTGCCCTTCTAGGAGCTTAATG 3′. RT-qPCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, 172-5124) in a CFX Connect RT-qPCR (Bio-Rad). Thermal cycling condition was as follows: 94°C for 10 minutes, followed by 40 cycles of 94°C for 20 seconds and 60°C for 60 seconds. Analysis of qPCR data was calculated using the fold enrichment method (the ChIP signals are divided by the IgG antibody signals, 2^–ΔΔCt).

ChIP assay was performed using the Magna ChIP^TM A kit (Millipore, Billerica, MA) according to manufacturer’s instructions. Briefly, cells were sonicated and lysed after protein/DNA cross-linking by 1% formaldehyde for 10 min. The crosslinked complex was immuno-precipitated by anti-NFATc2 antibody or control rabbit IgG (Cell Signaling, Beverly, MA) bound to protein A magnetic beads. After overnight incubation at 4°C, the complex was eluted and DNA was purified. The immune-precipitated DNA was quantified by qPCR using primer sequences designed to detect specific regulatory regions listed in Supplementary file 1B.

ChIP assay was performed using Magna ChIP^TM A kit (Millipore, Billerica, MA) according to manufacturer’s instructions. Quantification of antibody-bound region was done by qPCR performed with ABI Prism 7900HT (Applied Biosystems, Carlsbad, CA). Primers of SOX2 regulatory regions derived from public epigenetic maps spanning −5676 nt to +2460 nt were listed in the Supplementary Table S1. Rabbit IgG was used as negative control in the assay.

ChIP experiments were performed as previously described, with minor modifications (Kaufmann and Al. 2010). Specific antibodies targeting LcERF056 were synthesised (GenScript, Shanghai, China). In brief, 8-week-old seedlings (WT, RNAi, OE) were cross-linked with 1% formaldehyde. WT plants were used as control. The chromatin DNA fragments were isolated from their nuclei to retrieve binding DNA fragments by using rabbit polyclonal antibodies with the Magna ChIPTM A kit (Millipore). The bound DNA fragments were extracted using the Gel/PCR DNA fragments extraction kit (Millipore). The levels of the bound DNAs were measured through qPCR. Primer sequences are given in Supplemental Table S7.

LNCaP cells were grown in RPMI plus 10% FBS media for two days followed by androgen starvation for three days by replacing media with RPMI plus 10% CSS and then stimulated with 5 nM R1881 for 24 h. ChIP assay was performed using Magna ChIP A kit (Millipore, 17‐610) following the manufacturer’s guidelines. Briefly, cells were fixed with 1% formaldehyde followed by nuclear extraction and sonication using Covaris Sonalab 7 M220. Sheared chromatin from each sample was incubated with AR (Santacruz biotechnology, sc‐816) and rabbit IgG antibodies separately for overnight followed by washing, elution and reverse cross‐linking of DNA–protein complex. 5% of sheared chromatin was saved as input for the assay. DNA was further purified using spin columns provided in the kit following its instructions. Quantitative PCR was performed on the DNA purified after immunoprecipitation as well as input chromatin for SDHA, SDHB, PSA, and GAPDH probes (see probe sequences in Appendix Table S5) using SYBR green master mix (Qiagen). PCR data were normalized for housekeeping gene GAPDH and compared with input.

ChIP assays were performed using the Magna ChIP A Kit (Millipore) according to the manufacturer’s protocol. BHK cells were seeded in 10 cm dishes. 10 µg of pre-immune rabbit IgG or anti-Sp1 antibody (ChIP Grade, Abcam) was used for each ChIP reaction. Precipitated DNA was analyzed using a 7500 Real-Time PCR System (Applied Biosystems). The ZnT3 promoter primers used for ChIP-PCR assay are included in Table 1. The amount of amplified DNA was expressed as percent of the input. All ChIP assays were performed three times.