Total RNAs were isolated with RNA isolator total RNA extraction reagent (Takara), and cDNA was synthesized using PrimeScipt RT Master Mix (Takara). qPCR were performed with the ABI Prism 7500 sequence detection system according to the Prime-ScriptTM RT detection kit. PCR primers: E-cadherin, 5′-TACAACGACCCAACCCAA-3′ (sense) and 5′-TCCTCCGAAGAAACAG CA-3′ (antisense); periostin, 5′-CTGCCAAACAAGTTATTGAGCTGGC-3′ (sense) and 5′-AATAATGTCCAGTCTCCAGGTTG-3′ (antisense); GAPDH, 5′-AGAAGGCTGGGGCTCATTTG-3′ (sense) and 5′-AGGGGCCATCCACA GTCTTC-3′ (antisense). Relative levels of the sample mRNA expression were calculated and expressed as 2-DDCt.
Primescipt rt master mix
Manufactured by Takara Bio
Sourced in Japan
PrimeScipt RT Master Mix is a pre-mixed solution for reverse transcription. It contains all the necessary components, including reverse transcriptase, required for the conversion of RNA into complementary DNA (cDNA).
Automatically generated - may contain errors
Lab products found in correlation
Rna isolator total rna extraction reagent, by Takara Bio (4 mentions)
Abi prism 7500, by Thermo Fisher Scientific (3 mentions)
Premix ex taq 2, by Takara Bio (3 mentions)
Rna isolator total rna extraction reagent, by Vazyme (2 mentions)
Lightcycler 480 qpcr instrument, by Roche (2 mentions)
Abi prism 7500 sequence detector, by Thermo Fisher Scientific (1 mentions)
Rnaiso reagent, by Takara Bio (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Neutral protease, by Worthington (1 mentions)
Tb green, by Takara Bio (1 mentions)
Collagenase ia, by Worthington (1 mentions)
Dulbecco s modified eagle medium dmem, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr kit, by Thermo Fisher Scientific (1 mentions)
Cx96 detection system, by Bio-Rad (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Tiangen Biotech (1 mentions)
Sybr green detection, by Takara Bio (1 mentions)
14 protocols using primescipt rt master mix
1
RNA Extraction and qPCR Analysis
2
Quantification of Regulatory T-cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were homogenized in TRIzol reagent (Sigma-Aldrich), and RNA extraction was performed using TaKaRa RNAiso reagent (TaKaRa). For reverse transcription, cDNA was synthesized using a PrimeScipt™ RT Master Mix (TaKaRa). The real-time PCR efficiency for each primer pair was calculated using standard curves generated through serial dilution of cDNA from Tregs. Primer sequences are shown in Table 1 . PCR reactions were performed using an ABI PRISM 7500 Sequence Detector (Applied Biosystems). The PCR conditions were set as follows: an initial incubation step for 30 s at 95°C followed by 40 cycles of 5 s at 95°C and 34 s at 60°C. The normalized expression values for each transcript were calculated as the quantities of FOXP3, TGF-β and IL-10 mRNA relative to the quantity of β-ACTIN mRNA using the 2−ΔΔCt method. All reactions were performed independently at least three times.
Primer sequences for real-time PCR.
| Gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| β-ACTIN | ATCTGCTGGAAGGTGGACAGCGA | CCCAGCACAATGAAGATCAAGATCAT |
| FOXP3 | GTGGCCCGGATGTGAGAAG | GGAGCCCTTGTCGGATGATG |
| TGF-β | AACGAACTGGCTGTCTGC | CCTCTGCTCATTCCGCTTAG |
| IL-10 | GCTGGAGGACTTTAAGGGTTAC | ATGTCTGGGTCTTGGTTC |
FOXP-3, Forkhead box P3; IL-10, interleukin-10; TGF-β, transforming growth factor-β.
3
Mesenchymal Stem Cell Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reagents used in this study are listed under the form of “Reagent name (Company name, Item number)” as follows: Quercetin (MCE, HY-18085), LPS (InvivoGen, tlrl-pglps), IA collagenase (Worthington, LS004194), neutral protease (Worthington, LS02104), poly-d -lysine hydrobromide (PDL) (Sigma, P7886), fetal bovine serum (FBS) (Gibco, 2176404), Dulbecco’s modified Eagle medium (DMEM) (Gibco, 2318815), penicillin/streptomycin (Gibco, 2321127), iCell Primary Mesenchymal Stem Cells Serum-Free Media (iCell, PriMed-iCELL-012-SF), PrimeScipt RT Master Mix (Takara, RR047B), and TB Green (Takara, RR820B). Other reagents were obtained from Sigma-Aldrich Chemicals.
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using Trizol reagent (Invitrogen, United States) following the manufacturer’s instructions. cDNA was synthesized using PrimeScipt RT Master Mix (Takara, Japan). qPCR was performed on a Bio-rad Cx96 Detection System (Bio-rad, United States) by using a SYBR green PCR kit (Applied Biosystems, United States). The primers for the targeted genes were shown in Table 1 . Reaction conditions were 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min mRNA quantification was normalized to ACTB as an internal standard.
5
Colonic Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of homogenized colonic tissues was separated using TaKaRa RNA separation kit (TaKaRa Biotech, Kusatsu, Japan). The cDNA templates were synthesized from equal amounts of total RNA using PrimeScipt™RT Master Mix (TaKaRa Biotech, Japan). The genes of mucin 2 (MUC2), toll-like receptors (TLR4), nuclear factor-kappa B (NF-κB), and inhibitor of NF-κB (IκB-α) were determined by qPCR. The forward and reverse sequences of qPCR primers were designed as below: β-actin: 5′-AGCTGCGTTTTACACCCTT-3′ and 5′-AAGCCATGCCAATGTTGTC-3′; MUC2: 5′-CTGACCAAGAGCGAACACAA-3′ and 5′-CATGACTGGAAGCAACTGGA-3′. TLR4: 5′-CAGTAGAAATGGCTTGAGTTTC-3′ and 5′-GGTTTCTGAGTGATAGGAATAC-3′; NF-κB: 5′-GTCTGCGTCAAGACTGCTAC-3′ and 5′-ACAAGTTCATGTGGATGAGG-3′; IκB: 5′-CGAGACTTTCGAGGAAATACC-3′ and 5′-GTCTGCGTCAAGACTGCTAC-3′. The cDNA templates were amplified with SYBR Green by quantitative real-time PCR instrument (Xi’an Tianlong Science and Technology Co., Xi’an, China). The values of gene expression were normalized with β-actin, and calculated by the formula 2−ΔΔCt.
6
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole RNAs were extracted using the RNA isolator total RNA separation reagent, and PrimeScipt RT Master Mix (Takara, China) was employed to create cDNA. The qPCR was conducted utilising the ABI Prism 7500 sequencer reader and the Prime-ScriptTM RT identification kit. The levels of mRNA expression in the samples were computed and represented as 2-DDCt.
7
Quantitative Analysis of Spinal Dorsal Horn mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In brief, as directed by the manufacturers, total RNAs from the L4-6 spinal dorsal horn were isolated using the TRIzol Reagent (DP419, TIANGEN Biochemical Technology, Beijing, China). cDNA was acquired by means of PrimeScipt RT Master Mix (RR047A, TaKaRa, Japan) at 37°C for 15 min and 85°C for 5 s. 20 μL of qPCR reactions were prepared using Premix Ex TaqII (RR420A, TaKaRa, Japan), then run on an Applied Biosystems StepOnePlus Real-Time PCR System (Foster City, CA, United States). The mRNA expression was measured by means of the 2-ΔΔCT, and standardized to a single control group. The primer sequences (designed by Sangon Biotech, Shanghai, China) used in the experiment are presented in Table 3 .
8
TRIM11 Expression in NSCLC Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated with RNA isolator total RNA extraction reagent (Takara), and cDNA was synthesized using PrimeScipt RT Master Mix (Takara). qPCR was performed with the ABI Prism 7500 sequence detection system according to the Prime‐ScriptTM RT detection kit. Relative levels of the sample mRNA expression were calculated and expressed as 2‐ΔΔCT. Primer sequence: TRIM11: forward: 5′ ‐GTGCCTATGGAGCTGAGGAC‐3′; reverse: 5′ ‐CAGGATCAGCTCAGGGTTG‐3′; β‐actin: forward: 5′ ‐TACCTCATGAAGATCCTCACC‐3′; reverse: 5′ ‐TTTCGTGGATGCCACAGGAC‐3′. High TRIM11 expression of NSCLC patients ≥3 fold of TRIM11 expression of normal patients, and low TRIM11 expression of NSCLC patients <3‐ fold of TRIM11 expression of normal patients.
9
Quantitative Analysis of Wnt Pathway Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In brief, total RNAs were isolated with RNA isolator total RNA extraction reagent (Vazyme, R401-01) according to the manufacturer’s instructions. cDNA was synthesized using PrimeScipt RT Master Mix (Takara, RR036A). Ten microliters of qPCR reactions were prepared from 5 μl Premix Ex TaqII (Takara, RR820A), 0.5 μl primer (final concentration 10 nM), 2 μl DEPC water, and 2 μl cDNA. Reactions were run in a LightCycler 480 qPCR instrument (Roche) using the standard conditions 95 °C for 5 min, 40 cycles (95 °C for 15 s, 56 °C for 30 s, and 72 °C for 30 s) plus melting curve. Relative levels were quantified with the 2-ΔΔCT method that was normalized to the sham group. The primers used were as follows: β-actin forward: 5’-CCCATCTATGAGGGTTACGC-3’, β-actin reverse: 5’-TTTAATGTCACGCACGATTTC-3’; DKK3 forward: 5’-CCCCGACGGCCACTTGGACTC-3’, DKK3 reverse: 5’-GCCGCTTCTTCCGCCTCCATCT-3’; Kremen1 forward: 5’-CGGGCACCAGTAAGACGTCCAACA-3’, Kremen1 reverse: 5’-TGCCTCCCCGTGCTTCCAGTAGTC-3’; DVL-1 forward: 5’-TCGGGGTGGTGAAGGAGGAGATCT-3’, DVL-1 reverse: 5’-CCCCAATGCCGCCTGTCCTCTC-3’.
10
Quantification of Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with total RNA extraction reagent (Vazyme Biotech Co., Ltd.; cat. no. R401-01). According to the manufacturer's instructions, cDNA was synthesized using RT MasterMix (Applied Biological Materials, Inc.; cat. no. G485). The following conditions were used for RT: 25°C for 10 min, followed by 42°C for 15 min. qPCR reactions (10 µl) consisted of 5 µl PrimeScipt RT master mix (Takara Bio, Inc.), 0.5 µl primer (final concentration, 10 nM), 2 µl DEPC water and 2 µl cDNA. Reactions were run in a LightCycler 480 instrument II (Roche Diagnostics Co., Ltd.). qPCR with SYBR Green detection (Takara Bio, Inc.) was performed. qPCR amplification conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec, 56°C for 30 sec and 72°C for 30 sec. The following primers were used for cDNA amplification: Lats2: Forward, 5′-GACGATGTTTCCAACTGTCGCTGTG-3′ and reverse, 5′-CAACCAGCATCTCAAAGAGAATCACAC-3′; matrix metalloproteinase (MMP)-2: Forward, 5′-CAAGTTCCCCGGCGATGTC-3′ and reverse, 5′-TTCTGGTCAAGGTCACCTGTC-3′; and GAPDH: Forward, 5′-UUCUCCGAACGUGUCACGUTT-3′ and reverse, 5′-UUCUCCGAACGUGUCACGUTT-3′. Relative levels were quantified with the 2−ΔΔCq method and were normalized to GAPDH (23 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!