Transdux

Manufactured by System Biosciences

Sourced in United States

TransDux is a lentiviral transduction system designed for efficient gene delivery and stable gene expression in a variety of cell types. The system provides a simple and streamlined approach for introducing genes of interest into target cells.

Automatically generated - may contain errors

Lab products found in correlation

24 protocols using transdux

Organoid Lentiviral Transduction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intestinal organoids were cultured in ENR medium supplemented with 3 μM CHIR99021 and 500 ng/ml Wnt3a for 96 h before lentiviral transduction. Organoids were dissociated with TrypLE (Gibco) for 2 min in a 37°C water bath, washed once with 0.1% BSA/PBS, resuspended in ENR medium supplemented with 500 ng/ml Wnt3a, 10 μM Y27632 (#A9165; Sigma-Aldrich), and Transdux (#631231; System Bioscience) and mixed 1:1 with the lentiviral particles (1:1 mix of TLCV2-sgGata4-#1 and -#3 and TLCV2-sgGata4-#4fwd and -#4rev, respectively). Spinoculation was performed in PolyHEMA-coated 48-well plates at 1,000g for 1 h at RT, followed by 5-h incubation at 37°C. Transduced cells were then washed with 0.1% BSA/PBS, seeded in Matrigel, and cultured in ENR medium supplemented with 500 ng/ml Wnt3a and 10 μM Y27632 for 2 d. The medium was changed to basic ENR crypt medium and transduced organoids were selected with 1 μg/ml puromycin for 3 d starting from day 4 after transduction. Cas9 activity in stable organoids was induced with 600 ng/ml doxycycline (D5897; LKT Laboratories) for 3 d. Gata4 knockout organoids were analysed 5 d after mutagenesis.

Grinat J., Kosel F., Goveas N., Kranz A., Alexopoulou D., Rajewsky K., Sigal M., Stewart A.F, & Heuberger J. (2022). Epigenetic modifier balances Mapk and Wnt signalling in differentiation of goblet and Paneth cells. Life Science Alliance, 5(4), e202101187.

+ Open protocol

+ Expand

Generation of Cav-1 Knockout Lung Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to generate Cav-1 knock-out immortalized lung microvascular EC, HULEC-5a cells were first plated in 12 well plates. At ~ 40% confluence, the cells were transduced either with the Guide-4 coding lentivirus alone targeting exon-2, or with a combination of all four lentiviruses targeting exon-1, -2 and -3 of the Cav-1 gene and the cells were incubated for 6 hours in the presence of 10 μg/mL polybrene (Sigma-Aldrich Corp., St. Louis, MO) or TransDux™ (System Biosciences, Palo Alto, CA). The supernatant was then removed and the cells allowed to recover for 24h in complete MCDB-131 media, and then treated with 1 μg/mL doxycycline either for 1-3 days in time course experiments, or at least for four days in all other experiments and GFP expression monitored by microscopy. After doxycycline treatment, antibiotic selection (puromycin, 1 μg/ml) was applied for 48h, and surviving cells were used for further experiments when cultured in the presence of puromycin (0.25ug/ml).

Batori R.K., Chen F., Bordan Z., Haigh S., Su Y., Verin A.D., Barman S.A., Stepp D.W., Chakraborty T., Lucas R, & Fulton D.J. (2022). Protective role of Cav-1 in pneumolysin-induced endothelial barrier dysfunction. Frontiers in Immunology, 13, 945656.

+ Open protocol

+ Expand

Overexpression of miR-34a in Canine Osteosarcoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral constructs were purchased from Systems Biosciences (Mountain View, CA, USA). Packaging of the Lentiviral constructs was performed using the pPACKH1 Lentivector Packaging KIT (catalog no. LV500A-1) according to the manufacturer’s instructions. Canine OSA8 and Abrams cells were transduced with empty lentivirus (catalog no. CD511B-1) or pre-miR-34a lentivirus (catalog no. PMIRH34aPA-1). Briefly, 5 x 10⁵ cells were plated and left overnight in 10% serum-containing medium. The following day, the medium was changed to Stemline (Gibco) with transfection agent TransDux (Systems Biosciences) and either pre-miR-34a or control empty virus was added to cells overnight according to manufacturer’s protocol. Cells were FACS sorted based on GFP positivity 72 hour post-transduction and cells expressing the highest mean fluorescent intensity (top 30% of GFP+ population) were collected. Cells were expanded in culture for 5–7 days and miR-34a expression was determined by RT-qPCR (Applied Biosystems). After confirming overexpression of miR-34a Lentiviral constructs, cells were plated immediately for functional assays (cell proliferation, cell cycle analysis, invasion/migration).

Lopez C.M., Yu P.Y., Zhang X., Yilmaz A.S., London C.A, & Fenger J.M. (2018). MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines. PLoS ONE, 13(1), e0190086.

+ Open protocol

+ Expand

ERCC3 Silencing and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

ERCC3 small interfering RNA (siRNA) (Thermo Fisher S4796) was used following the manufacturer’s instructions. Non-targeting scrambled negative control siRNA (Thermo Fisher AM4611) was used as a negative control. KU-19-19, HCV29 or Bca0928 cells were transiently transfected with 50 pmol Si-ERCC3 or control siRNA by Lipofectamine RNAiMAX (Thermo Fisher). The transfected cells were collected after 48 h transfection for WB analysis or re-plated into 96-well plates for cell viability assays or into 24-well plates for NER assays. LentiORF human ERCC3 (clone ID: PLOHS_100006334, Cat. No. OHS5897) and LentiORF control (Cat. No. OHS5832) were obtained from Horizon Discovery. Lentivirus particles were produced in HEK293T cells by co-transfection with pMD2.G and psPAX2. Lentivirus particles were used to transfect indicated cells using TransDux^™ (System Biosciences) for 48 h. The stable transfected cells were selected by Blasticidin S.

Xu D., Cao Q., Wang L., Wang J., Xu B., Attwood K., Wei L., Wu Y., Smith G., Katsuta E., Takabe K., Chatta G., Guru K., Goodrich D.W, & Li Q.J. (2022). A Preclinical Study to Repurpose Spironolactone for Enhancing Chemotherapy Response in Bladder Cancer. Molecular cancer therapeutics, 21(5), 786-798.

+ Open protocol

+ Expand

Lentiviral Knockdown of EZH2 in CML

Check if the same lab product or an alternative is used in the 5 most similar protocols

EZH2 shRNAs were subcloned from the pLKO.1 puro vector (Sigma Mission shRNA collection) into the NdeI and SpeI sites of the pLKO.1 GFP vector. Sequences for EZH2 shRNA 1 and 3 are CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCT AGCTTTTTG and CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG respectively. A scrambled, non-targeting shRNA was used as a control. 10 μg of each shRNA were transfected into 293 T human embryonic kidney (HEK) cells along with 6.5 μg Hiv1 and 3 μg VSV-G constructs. After 24 hrs, the medium was replaced with DMEM containing 20% serum. KCL22 cells or CML CD34⁺ cells were transduced in 2 consecutive rounds of 24 and 48 hrs with lentiviral supernatant supplemented with Transdux (Systems Biosciences). Transduction efficiency (% GFP⁺ cells) was measured by flow cytometry. GFP positive cells were isolated by FACS using a FACS Aria cell sorter and knockdown assessed at the mRNA and protein level.

Scott M.T., Korfi K., Saffrey P., Hopcroft L.E., Kinstrie R., Pellicano F., Guenther C., Gallipoli P., Cruz M., Dunn K., Jorgensen H.G., Cassels J.E., Hamilton A., Crossan A., Sinclair A., Holyoake T.L, & Vetrie D. (2016). Epigenetic reprogramming sensitizes CML stem cells to combined EZH2 and tyrosine kinase inhibition. Cancer discovery, 6(11), 1248-1257.

+ Open protocol

+ Expand

Jurkat Clone E6-1 Cell Engineering

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Jurkat Clone E6–1 suspension cell line was engineered with lentivirus particles carrying the appropriate (fully assembled (Figure 1B) or control) T-cell Biofactory insert in the presence of TransDux (System Biosciences, Cat# LV850A-1) following the manufacturer’s instruction. After 48 h, cells were placed in selection using 0.2 mg mL⁻¹ of puromycin dihydrochloride. The unmodified parental cell line was also placed under selection as a positive control for cell killing by puromycin. Following selection, cells were expanded as required for different assays and frozen using freezing media (complete culture medium and 10% DMSO) for liquid nitrogen stocks.

Repellin C.E., Patel P., Beviglia L., Javitz H., Sambucetti L, & Bhatnagar P. (2018). Modular Antigen-Specific T-cell Biofactories for Calibrated In Vivo Synthesis of Engineered Proteins. Advanced biosystems, 2(12), 1800210.

+ Open protocol

+ Expand

Lentiviral Overexpression of SLFN11

Check if the same lab product or an alternative is used in the 5 most similar protocols

SLFN11 cDNA was amplified using the forward primer (5′- ATCGGATCC GCGGCCAACATGGAGGCAAATCAGTGC-3′) and the reverse primer with the sequence for the Flag tag (5′-ATTGTCGACGCGGCCCTACTTATCGT CGTCAT CCTTGTAATCATGGCCACCCCACGGAA-3′) and cloned into pCDH-EF1-MCS-(PGK-copGFP) lentiviral expression vector (System Biosciences) by In-Fusion HD cloning kit (Clontech). The lentiviral SLFN11-expressing vector and the pPACKH1 lentivector packaging plasmids were cotransfected into 293TN cells (System Biosciences) and the viral particles were collected to infect K562 cells with Transdux™ (System Biosciences). The SLFN11-expressing cells with GFP signal were sorted using a Fluorescence Activated Cell Sorter (FACS).

Murai J., Feng Y., Yu G.K., Ru Y., Tang S.W., Shen Y, & Pommier Y. (2016). Resistance to PARP inhibitors by SLFN11 inactivation can be overcome by ATR inhibition. Oncotarget, 7(47), 76534-76550.

+ Open protocol

+ Expand

Lentiviral Transduction of Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

hPOs were expanded to passage 3, after which organoids were made into single cells as described above. 1 × 10⁵ cells were resuspended in virus infection medium containing [CMV-GFP-T2A-Luciferase pre-packaged virus (Systems Bioscience, Cat. No. BLIV101VA-1) at a multiplicity of infection (MOI) of 5 (5x10⁵u/μl) with 1:200 TransDux (System Bioscience) and 1:5 MAX Enhancer (Systems Bioscience) with hPO-Opt.EM]. The cell suspension was added to a 24 well plate, spun at 32 °C at 600 g for 10 min and then incubated at 37 °C for 6 h. Cells were then transferred to a 15 mL centrifuge tube, washed twice with Basal Medium and seeded in a 48 well plate with BME 2 and overlayed with hPO-Opt.EM supplemented with Rho Kinase inhibitor.
After 2 passages, cells were again subjected to a single cell dissociation as described above. Single cell preparations, along with negative controls (non-transduced hPOs) were sorted using a MoFlo cell sorter. GFP+ cells were seeded into 48 well plates with BME 2 and hPO-Opt.EM medium (with Rho Kinase inhibitor for the first 7 days). Organoids were expanded for 2 passages and imaged with the Evos Fl Imaging system (Thermofisher) for expression of GFP.

Georgakopoulos N., Prior N., Angres B., Mastrogiovanni G., Cagan A., Harrison D., Hindley C.J., Arnes-Benito R., Liau S.S., Curd A., Ivory N., Simons B.D., Martincorena I., Wurst H., Saeb-Parsy K, & Huch M. (2020). Long-term expansion, genomic stability and in vivo safety of adult human pancreas organoids. BMC Developmental Biology, 20, 4.

+ Open protocol

+ Expand

Isolation and Lentiviral Transduction of Tooth Germs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tooth germs were isolated from E15 mouse mandibles and then cultured in DMEM (Gibco, NH, USA) including 10% FBS and 1% penicillin and streptomycin at 37°C and 5% CO₂ for 2 days. Lentivirus were produced following one hundred milliliters of concentrated Sox2‐expressing lentivirus was added to 1 mL of culture medium containing TransDux (SystemBiosciences, CA, USA).

Kim E., Jung S., Wu Z., Zhang S, & Jung H. (2019). Sox2 maintains epithelial cell proliferation in the successional dental lamina. Cell Proliferation, 53(1), e12729.

+ Open protocol

+ Expand

Transient and Lentiviral Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

For transient transfection, cells were transfected by Lipofectamine 2000 as previously described (Lee et al., 2007 (link)). Briefly, cells were seeded 24 hours before transfection, and the plasmid(s) and Lipofectamine reagent were combined in Opti-MEM media. Media was then replaced with regular media without antibiotics 6 hours later. For lentivirus production, a lentiviral construct (pCDH-CMV-MCS-EF1α-RFP plasmids for overexpressing circRNA-GFP, Tet-pLKO-puro for inducible knockdown of METTL3 or WTAP, pCDG-EF1α-CymR-T2A-Neo for cumate repressor, pCDH-CuO-MCS-EF1α-RFP for inducible overexpression of METTL3-T2A-WTAP, or pLenti-DsRed-IRES-METTL3-EGFP as METTL3 protein stability reporter) together with pMD2.G and psPAX2 were co-transfected into 293TN cells (System Biosciences). Viruses were concentrated by the PEG-it Virus Precipitation Solution and used for infecting cells in the presence of TransDux (System Biosciences). Pools of stable transfectants were selected by antibiotics or sorted by flow cytometry. Doxycycline (0.5 μg/mL) was used to induce shRNA while cumate (50 μg/mL) was used to induce shRNA-resistant cDNA expression.

Sun H.L., Zhu A.C., Gao Y., Terajima H., Fei Q., Liu S., Zhang L., Zhang Z., Harada B.T., He Y.Y., Bissonnette M.B., Hung M.C, & He C. (2020). Stabilization of ERK-Phosphorylated METTL3 by USP5 Increases m6A Methylation. Molecular cell, 80(4), 633-647.e7.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!