Total RNA from human adult testis (Ambion), somatic tissues (Human Total RNA master panel II, Clontech) and cell lines was reverse transcribed and subject to quantitative PCR in Sybr Master Mix (Roche) with 20 nM primer. Ribosomal protein Rpl13a was used as a reference gene. Primer sequences are as follows: Hiwi F: ACGCTGCATATTTCAGGATAGA, Hiwi R: GACAGTGACAGATTTGGCTCTC, Hili F: CGCATTATGTCTGTGTTCTCAA, Hiwi R: AAGCGATTCTCCTGCCTTAG, Hiwi2 F: AATGCTCGCTTTGAACTAGAGAC, Hiwi2 R: ATTTTGGGGTAGTCCACATTAAATC, Rpl13a F: CCTGGAGGAGAAGAGGAAAGAGA, Rpl13a R: TGTCATACCAGGAAATGAGC.
Sybr master mix
Manufactured by Roche
Sourced in United States, Switzerland, Germany
SYBR Master Mix is a ready-to-use solution for real-time PCR amplification and detection. It contains a DNA-binding dye, SYBR Green I, and all the necessary components for efficient PCR amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (9 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Lc480, by Roche (5 mentions)
Pcr thermal cycler, by Bio-Rad (3 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Cfx connect real time system, by Bio-Rad (3 mentions)
Biophotometer plus, by Eppendorf (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol method, by Thermo Fisher Scientific (2 mentions)
Reverse transcription system, by Roche (2 mentions)
Human total rna master panel 2, by Takara Bio (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio 6 flex, by Thermo Fisher Scientific (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent, by Takara Bio (1 mentions)
34 protocols using sybr master mix
1
Quantitative PCR Analysis of Germ Cell Genes
2
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction and quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) were conducted following a previous report [18 (link)]. Total RNA was extracted from UC-MSCs and macrophages using TRIzol (Invitrogen) according to the manufacturer’s protocol. A Biophotometer Plus (Eppendorf, Germany) was used to detect the amount and purity of the total RNA at absorbance wavelengths of 260 nm and 280 nm. Then, the RNA was reverse transcribed into cDNA by a Transcriptor First-Strand cDNA Synthesis Kit (Roche, Applied Science, USA), and the cDNA was amplified for 10 min at 65 °C, incubated at 55 °C for 30 min, deactivated at 85 °C for 5 min, and finally stored at 4 °C for 5 min in a PCR thermal cycler (Bio-Rad, USA). RT-qPCR was conducted with SYBR Master Mix (Roche Applied Science) using a reverse transcription system (LC-480, Roche, USA). β-actin was used as the housekeeping gene. The sequences of the target gene-specific primers used in this study are shown in Supplementary Table 1 .
3
Quantifying Gene Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from BEAS-2B, H1299 and A549 cell lines using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. cDNA was synthesized from total RNA (1,000 ng) using High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the temperature protocol of 25°C for 10 min, 37°C for 120 min and 85°C for 5min. qPCR was performed using the SYBR Master Mix (Roche Diagnostics, Basel, Switzerland). All the primers were designed and synthesized by the Sangon Biotech Co., Ltd., (Shanghai, China). The primer sequences were as follows: PADI4 forward: 5′-CACAGCTCTGGTTGGCTTCA-3′, reverse: 5′-CTGCACGTCCTTCAGCATCA-3′; GAPDH forward: 5′-CGGAGTCAACGGATTTGGTCGTAT-3′, reverse: 5′-AGCCTTCTCCATGGTGGTGAAGAC-3′. The assays were performed on the 7500 Fast Real-Time PCR System (Applied Biosystem; Thermo Fisher Scientific, Inc.). The quantitative RT-PCR thermal cycling conditions included one cycle for 60 sec at 95°C and 40 cycles of 15 sec at 95°C, 15 sec at 60°C and 45 sec at 72°C. The results were calculated using the ΔΔ quantification cycle (Cq) method (20 (link)) and then normalized to the endogenous reference control gene GAPDH.
4
Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol reagent (Thermofisher) and first strand cDNA was synthesized (Roche, Basel, Switzerland). Quantitative real-time PCR was performed with SYBR master mix (Roche, USA) on the platform of LC480 (Roche). Primers used were as follows, CBX3: (Forward) 5′-GGTGAACTCTTCAAGTCTCCG-3′, (Reverse) 5′-TTATTGTGCT TCATCTTCAGGACAAG-3′; PCNA (Forward) 5′-GGCTCCATCCTCAAGAAGGT-3′, (Reverse) 5′-AGTCCATGCTCTGCAGGTTT-3′; CDK1 (Forward) 5′-TTTTCAGAGCTTTGGGCACT-3′, (Reverse) 5′-CCATTTTGCCAGAAATTCGT-3′; GAPDH (Forward) 5′-CATGAGAAGTATGACAACAGCCT-3′, (Reverse) 5′-AGTCCTTCCACGATACCAAAGT-3′. Expression of CBX3, PCNA and CDK1 was normalized by GAPDH.
5
Quantitative RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was performed as described previously (Onishi et al., 2012 (link)). In brief, RNA was isolated using the PureLink RNA Mini Kit (Ambion) and reverse transcribed with Superscript III (Life Technologies). PCR was performed on the QuantStudio 6 Flex (Life Technologies) using SYBR Master Mix (Roche) and primers provided by the Center for Commercialization of Regenerative Medicine. Gene NCBI-RefSeq accession numbers are provided in Table S4 .
6
RNA Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After TRIzol Reagent (Invitrogen) treatment, total RNA from cells or clinical samples was prepared, followed by reverse transcription with miRNA First‐Strand Synthesis Kit (for miRNA; Clontech, Mountain View, CA, USA) or a Primescript RT Reagent (for mRNA/circRNA; TaKaRa, Kusatsu, Japan). Polymerase chain reaction (PCR) detection was prepared by SYBR Master Mix (Roche, Basel, Switzerland). After being normalized with U6 (for miRNA) or Glyceraldehyde‐3‐phosphate Dehydrogenase (GAPDH) (for mRNA/circRNA), the collected data were calculated by the 2−ΔΔCt method. RT‐qPCR assay was performed at least three times. Primer information was listed in Table 2 .
7
Quantitative Gene Expression Analysis
8
RT-qPCR Analysis of Whole Blood RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were extracted from whole blood for use in RT-qPCR using TRIzol (Invitrogen, Life Technologies, USA), according to the manufacturer’s instructions. Total RNA purity and concentration were evaluated using an ultraviolet spectrophotometer (BioMate 3S UV-visible spectrophotometer; ThermoFisher Scientific). Total RNA samples aliquots (1 µg) were used to synthesize cDNA, using a cDNA Synthesis Kit (Roche Applied Science, Indianapolis, USA), and qRT–PCR conducted with a reverse transcription system (LC-480, Roche, USA) using SYBR Master Mix (Roche Applied Science). The housekeeping genes, GAPDH and HPRT, served as internal controls for cDNA normalization. All primer sequences used in this study are listed in Table S3
9
Quantitative Gene Expression Analysis of Liver, HSC, and HUVEC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from rat liver tissues, HSCs, and HUVECs with TRIzol (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed with 500 ng total RNA and Superscript III reverse transcriptase (Invitrogen). Real-time PCR was performed using SYBR Master Mix (Roche) and the CFX Connect™ Real-Time System (BIO-RAD). GAPDH were used as internal controls for gene expression assays. The sequences of the primers are shown in Table 1 . All reactions were performed in triplicate.
10
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was purified by phenol: chloroform extraction and isopropanol precipitation. Total RNA was prepared using commercial kits with on-column DNase I digestion (5 Prime, Zymo). cDNA was prepared using MMLV reverse transcriptase (NEB ProtoScript II) with oligo-dT primers. Quantitative real-time PCR (qPCR) was performed on a Roche LC480 with Roche SYBR Master mix as described [22] (link) and primers in Supplementary Table T1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!