Taqman fast universal pcr master mix kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The TaqMan Fast Universal PCR Master Mix kit is a ready-to-use solution for performing real-time PCR amplification. It contains all the necessary components, including a thermostable DNA polymerase, dNTPs, and optimized buffer system, to perform fast and efficient PCR reactions.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

TaqMan Fast Universal PCR Mix TaqMan Universal PCR master TaqMan Fast-PCR kit Taqman universal mix Fast Taqman mix TaqMan Master Mix Universal Master Mix PCR Master Mix TaqMan PCR kit TaqMan kits

6 protocols using taqman fast universal pcr master mix kit

Quantifying Esophageal Histamine Receptor Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from human esophageal biopsies using Mirvana miRNA isolation kit (Ambion, Carlsbad, CA). RNA was isolated from EPC2-hTERT and primary esophageal epithelial cells using an RNeasy kit (Qiagen, Valencia, CA) according to manufacturer’s recommendations. RNA samples were reverse transcribed using a high capacity cDNA reverse transcriptase kit according to manufacturer’s instructions (Applied Biosystems, Foster City, CA). Pre-formulated Taqman Gene Expression Assays were purchased from Applied Biosystems for H1R (Hs00185542_m1), H2R (Hs00254569_s1), H3R (Hs00200610_m1), H4R (Hs00222094_m1), and GAPDH (4352934E). Quantitative RT-PCR was performed using the Taqman Fast Universal PCR Master Mix kit (Applied Biosystems) and reactions were performed in triplicate using 96-well optical plates on a StepOnePlus Real-Time PCR System (Applied Biosystems). GAPDH was used as an endogenous control to normalize the samples using the ΔΔC_T method of relative quantitation, where C_T is the threshold cycle.

Merves J., Chandramouleeswaran P.M., Benitez A.J., Muir A.B., Lee A.J., Lim D.M., Dods K., Mehta I., Ruchelli E.D., Nakagawa H., Spergel J.M, & Wang M.L. (2015). Altered Esophageal Histamine Receptor Expression in Eosinophilic Esophagitis (EoE): Implications on Disease Pathogenesis. PLoS ONE, 10(2), e0114831.

+ Open protocol

+ Expand

Spinal Cord RNA Extraction and Real-Time qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 5 mm segment of the ipsilateral side of the spinal cord centered on the impact site was removed for extraction of RNA. Total RNA was extracted using a Trizol Reagent (Invitrogen, CA, USA) according to the manufacturers’ manual. Quantitative PCR reactions were performed using the TaqMan Fast Universal PCR Master Mix Kit (Applied Biosystems, CA, US)^{35 (link)}. The mRNA for peroxisome proliferator-activated receptor-gamma coactivator 1α (PGC-1α) was measured by real-time quantitative RTPCR using PE Applied Biosystems prism model 7700. Triplicate reactions were run for each sample for both the gene of interest and the endogenous control (glyceraldehyde-3-phosphate dehydrogenase; GAPDH). Results are presented as 2-dCt, where dCt was difference between cycle threshold (Ct) values of GAPDH and gene of interest, a calculation that compensates for loading errors. Subtraction of dCt of CD rats from dCt of KD rats gives the ddCt value that was used to calculate relative expression levels in KD animals (2-ddCt) as previously described^{35 (link)}.

Seira O., Kolehmainen K., Liu J., Streijger F., Haegert A., Lebihan S., Boushel R, & Tetzlaff W. (2021). Ketogenesis controls mitochondrial gene expression and rescues mitochondrial bioenergetics after cervical spinal cord injury in rats. Scientific Reports, 11, 16359.

+ Open protocol

+ Expand

Quantitative Analysis of Collagen and EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was purified using an RNeasy Kit (Qiagen, Valencia, CA) according to manufacturer’s recommendations. RNA samples were reverse transcribed using a high-capacity cDNA reverse transcriptase kit (Applied Biosystems, Foster City, CA). Pre-formulated TaqMan Gene Expression Assays were purchased from Applied Biosystems for human type I collagen (COL1A) (Hs00164004), α-smooth muscle actin (ACTA2) (Hs00426835), vimentin (VIM) (Hs00185584), E-cadherin (CDH1) (Hs01023894), and GAPDH (4352934E). Quantitative RT-PCR was performed using TaqMan Fast Universal PCR Master Mix kit and reactions were performed in triplicate using 96-well optical plates on a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). GAPDH was used as an endogenous control to normalize the samples using C_t method of relative quantification, where C_t is the threshold cycle.

Muir A.B., Dods K., Noah Y., Toltzis S., Chandramouleeswaran P.M., Lee A., Benitez A., Bedenbaugh A., Falk G.W., Wells R.G., Nakagawa H, & Wang M.L. (2014). Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition. Experimental cell research, 330(1), 102-110.

+ Open protocol

+ Expand

HTLV-1 Proviral Load Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

HTLV-1 PVL was quantified by real-time PCR using 30 ng of DNA and the TaqMan Fast Universal PCR Master Mix kit (Applied Biosystems) in the 7500 Fast Real-Time PCR System (Applied Biosystems). The sequences of the primers and probes were as follows: 5’-CCC ACT TCC CAG GGT TTG GA-3’, 5’-GGC CAG TAG GGC GTG A-3’, and 5’-FAM/CCA GTC TAC/ZEN/GTG TTT GGA GAC TGT GTA CA/3IABkFQ/-3’for the tax gene and 5’- GTG CAC CTG ACT CCT GAG GAG A-3’, 5’-CCT TGA TAC CAA CCTGCC CAG-3’and 5’-FAM/AAG GTG AAC/ZEN/GTG GAT GAA GTT GGT GG/3IABkFQ/-3’for the beta-globin gene. The reaction conditions were 95ºC for 20s and then 40 cycles of 3s at 95ºC, followed by 30s at 60ºC.
PVL was quantified as the number of HTLV-1 DNA copies per 100 PBMCs, was calculated according to the following formula: = (copy number of Tax)/ (copy number of beta-globin/2)]·100, and was expressed HTLV-1 copies per 100 PBMC or as percentage.

Batista E.S., Oliveira P.D., Primo J., Varandas C.M., Nunes A.P., Bittencourt A.L, & Farre L. (2019). HTLV-1 proviral load in infective dermatitis associated with HTLV-1 does not increase after the development of HTLV-1-associated myelopathy/tropical spastic paraparesis and does not decrease after IDH remission. PLoS Neglected Tropical Diseases, 13(12), e0007705.

+ Open protocol

+ Expand

TGF-β1 Induced Fibrogenic Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded in 24-well plates and stimulated in triplicate with or without 10 ng/mL recombinant human (rh) TGFβ1 for 1 week. Total RNA was purified using an RNeasy kit (Qiagen, Valencia, CA) according to manufacturer's instructions and quantitated by spectrophotometry with NanoDrop 2000c (Thermo Fisher Scientific). RNA was reverse transcribed using a high-capacity cDNA reverse transcriptase kit (Applied Biosystems, Foster City, CA) and subjected to TaqMan Gene Expression Assays (Applied Biosystems) for type I collagen (COL1A1, Hs00164004), α-SMA (ACTA2, Hs00426835), fibronectin (FN1, Hs01549940), and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, 4352665). PCR reaction was carried out in triplicate using TaqMan Fast Universal PCR Master Mix kit (Applied Biosystems) and 96-well optical plates on the StepOnePlus Real-Time PCR System (Applied Biosystems). The relative expression level of each mRNA transcript was normalized to GAPDH as an internal control as described previously^{18 (link)}.

Muir A.B., Dods K., Henry S.J., Benitez A.J., Lee D., Whelan K.A., DeMarshall M., Hammer D.A., Falk G., Wells R.G., Spergel J.M., Nakagawa H, & Wang M.L. (2016). Eosinophilic esophagitis associated chemical and mechanical microenvironment shapes esophageal fibroblast behavior. Journal of pediatric gastroenterology and nutrition, 63(2), 200-209.

+ Open protocol

+ Expand

Mouse Paw RNA Analysis of COX Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the mouse paws prepared for the detection of COX-1 and COX-2 were isolated with TRIzol Reagent (Gibco, Grand Island, NY, United States) following the manufacturer’s instructions. From each sample, 1.5 μg RNA was employed to synthesize cDNA using Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, United States) following the manufacturer’s protocol. RT-PCR was performed in a TaqMan fast universal PCR master mix kit (2 ×; Applied Biosystems, Foster City, CA, United States), under the Applied Biosystems Step-One Fast Real-Time PCR system, and the Sequence Detection Software 2.0 (Applied Biosystems, Inc., FosterCity, CA, United States) was used to analyze the results. The oligonucleotide primers for COX-1, designed from mouse (NM_008969.4), were CCTACAGCCCTTCAATGAATACC (forward) and GATGTCACCGTACAGCTCCTCC (reverse), respectively; for COX-2, designed from mouse (NC_010339), were ATAGACGAAATCAACAACCCCG (forward) and GGATTGGAAGTTCTATTGGCAG (reverse), respectively; for β-actin, designed from mouse (NM_007393.3), were GTGACGTTGACATCCGTAAAGA (forward) and GTAACAGTCCGCCTAGAAGCAC (reverse), respectively. The results were presented as the ratio of optimal density to β-actin.

Zhang Z.B., Luo D.D., Xie J.H., Xian Y.F., Lai Z.Q., Liu Y.H., Liu W.H., Chen J.N., Lai X.P., Lin Z.X, & Su Z.R. (2018). Curcumin’s Metabolites, Tetrahydrocurcumin and Octahydrocurcumin, Possess Superior Anti-inflammatory Effects in vivo Through Suppression of TAK1-NF-κB Pathway. Frontiers in Pharmacology, 9, 1181.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!