Siscrambled

For shRNA treatment, endothelial cells were infected with lentiviral particles according to Addgene “plKO.1 Protocol” (http://www.addgene.org/tools/protocols/plko/). Cells were selected with puromycin (0.5 μg/ml). The PHF8 target sequence was: 5’- CCGGCCCAACTGTGAAGTCTTGCATCTCGAGATGCAAGACTTCACAGTTGGGTTTTTG -3’. Control shRNA against green fluorescent protein (shGFP) and shScrambled (shScr) were purchased from Addgene. For siRNA treatment, endothelial cells (80–90% confluent) were transfected with GeneTrans II according to the instructions provided by MoBiTec (Göttingen,Germany). siRNAs for PHF8 were purchased from Sigma (siPHF8-1: #SASI_Hs01_00079031, siPHF8-2: #SASI_Hs01_00079033, siPHF8-3, SASI_Hs01_00079032). siE2F4 was purchased from ThermoFisher Scientific (#114193 siE2F4-1 and #114194 siE2F4-2). Control siRNAs (siScrambled) were from Invitrogen (siScr-1: #12935–300, siScr-2: #12935112, siScr-3: #12935113). Plasmid overexpression was achieved with the Neon electroporation system (Invitrogen). The plasmid PHF8 (vector: pcDNA3) was kindly provided by Shi Yang (Harvard Medical School, Department of Cell Biology) [13 (link)], E2F1 and E2F4 (vector: pcDNA3) plasmids were from Addgene (24225# and #10914).

siRNA targeting human Caveolin 1 (39) β-catenin (35) were purchased from Dharmacon as a SMART pool mix of four sequences and PTEN (38) from Santa Cruz Biotechnologies as a mix of three sequences. Caveolin-1: 5′-GCA AAU ACG UAG ACU CGG A-3′, 5′-AUU AAG AGC UUC CUG AUU G-3′, 5′-GCA GUU GUA CCA UGC AUU A-3′ and 5′-CUA AAC ACC UCA ACG AUG A-3′. β-catenin: 5′-GAA CGC AGC AGC AGU UUG U-3′, 5′-CAG CUG GCC UGG UUU GAU A-3′, 5′-GCA AGU AGC UGA UAU UGA C-3′ and 5′-GAU CUU AGC UUA UGG CAA U-3′. si Scrambled, with no known human targets, was purchased from Invitrogen as a mix. Briefly, cells were transfected with 50 pmol of siPTEN, siCAV1, siβ-catenin or siScrambled (siScr) and were assayed for Luciferase activity or protein content 48 h post transfection.