Paxgene blood rna kit

Whole blood was collected in PAXgene tubes (BD 762165, Switzerland) at the time of enrollment and frozen within 24 hours of collection. RNA was isolated using the PAXgene blood RNA kit (BD 762164, Switzerland). First strand cDNA was made using QuantiTect® Reverse Transcription Kit (Qiagen) from 1ug total RNA. Quantitative real-time PCR was performed using a total reaction volume of 25 μL, containing 5 μL of diluted cDNA, 12.5 μL SYBR Green Supermix (Applied Biosystems Foster City, CA) and 0.03 μL of each oligonucleotide primer (250 μM). PCR was carried out in a StepOnePlus Real Time PCR System (Applied Biosystems) using 40 cycles of 95°C for 15 seconds followed by 60°C for 1 minute with a ten minute 95°C initial soak. Each measurement was made in triplicate and expressed relative to the detection of the standard hypoxanthine guanine phosphoribosyl transferase (HPRT). A priori we planned to perform PCR for the 25 genes that had the greatest intergroup expression difference, as identified by microarray. PCR was performed for the primer sets of these genes: HPRT, EPDR1, DSG2, SCD5, P2RY5, MGAT5, RHOQ, UCHL1, ZNF652, RALGPS2, TPD2, MKNL1, RAPGEF2, PIAS1, ARRB2, MBNL1, PDE7, CLEC2B, EPS8, FNBP1, STX16, DAPK1, SLC33A1, B4GALT5, ZNF207, FOXN3 (Integrated DNA Technologies IDT® Coralville, Iowa).

RNA was extracted from blood using PAXgene Blood RNA Kit (BD biosciences Inc. San Jose, USA) according to the manufacturer's instructions. Reverse Transcription PCR (RT-PCR) was performed using OneStep RT-PCR Kit (Qiagen Inc. Maryland, USA) according to the manufacturer's instructions using specific primers targeting the potential splice-sites. The c.16024–13C>G variant in intron 83 of the SYNE1 gene was targeted using primers in exon 82 (CATGCAGGAGAAAGTGAAGA) and exon 85 (TGGTCTGCTGGTGAAGTTCA). The c.1529C>T and c.2181+5G>A variants in exon 11 and intron 16 of the SPG7 gene, respectively, were targeted using a combination of primers in exon 10 (TTCATTGATCTCCCCACGCT), exon 15 (ACTCCATGGTGAAGCAGTTTG), exon 17 (CCCAAGTCCTGTTTCTCCCT) and 3’UTR (CAAACCTCAGCTGAAAAGCAA). Amplification products were sequenced using ABI’s dye-terminator chemistry (Applied Biosystems Inc. Foster City, USA).