The CPSF3 gene was amplified using primers ‘ATGCTCCCTGCGGCAGCAGCAGTAA’ and ‘TTACACAGCCTCCTCTGGCAAAGGCT’, and integrated into the pTrex vector47 (link) by NEBuilder HiFi DNA assembly (New England Biolabs). The construct pTrex-CPSF was then transfected into Brazil tdTomato epimastigotes and selected by 60 ug ml−1 blasticidin.
To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described14 (link) and converted to complementary DNA (cDNA) using SuperScript reverse transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5’-TGAAACAGCAGCATGCCAAC-3’ and 5’-CGCGTCTGTCTACCATCAGA-3’) and CPSF-2 (5’-CGGCTCATTCTGATGGTAGACA-3’ and 5’-TGTGCGTTGCACACTGAATG-3’) in both control and CPSF overexpressing parasites. The expression level was normalized to tubulin and amplified using primers ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.
To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described14 (link) and converted to complementary DNA (cDNA) using SuperScript reverse transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5’-TGAAACAGCAGCATGCCAAC-3’ and 5’-CGCGTCTGTCTACCATCAGA-3’) and CPSF-2 (5’-CGGCTCATTCTGATGGTAGACA-3’ and 5’-TGTGCGTTGCACACTGAATG-3’) in both control and CPSF overexpressing parasites. The expression level was normalized to tubulin and amplified using primers ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.