Typer software

The mosaic mutation was confirmed by using iPLEX and MALDI-TOF MS (Agena Bioscience, Hamburg, Germany). The iPLEX reaction was performed according to the standard protocol recommended by the system supplier (21 (link)). The homogeneous MassEXTEND (hME) and iPLEX process reley on a small volume PCR amplifying the target regions including the SNP position in a multiplex fashion. The basic principle of hME and iPLEX reaction is identical. Both methods use a third, so-called MassEXTEND primer, which anneals directly adjacent to the SNP position. In an enzymatic primer extension reaction, this primer will be elongated. During that process the allele-specific analytical products are generated. The products differ by mass according to the incorporated bases. Primers were designed: ACGTTGGATGCTGTGAGCACCAATTTGGAC (PHEX-ex21_PCR1) and ACGTTGGATGTTCTCTTCTAGGTGAGGTGC (PHEX-ex21_PCR2), with the tag-sequences in italics. For the iPLEX-reaction the primer sequences were: ACAGACCAGAAGCTGCC (left) and CCAATTTGGACTTGTTCTC (right). The sample carrier was introduced into the mass spectrometer (MassARRAY Analyzer Compact, Agena Bioscience) and data are fully automatically acquired and analyzed in a real-time setting and revised using Typer software (Agena Bioscience).

DNA was extracted from blood samples using DNeasy Blood and Tissue kit (Qiagen). The genotyping was performed using a multiplexed primer extension (SBE) chemistry of the iPLEX assay with detection of the incorporated allele by mass spectrometry with a MassARRAY analyzer from Agena Bioscience. Raw data from the mass reader was converted to genotype data using the Typer software (Agena Bioscience). Reproducibility was controlled to be 100%. The tool PLINK (version 1.07)^{64 (link)} was used for Chi-square calculations to test for association between SNV allele and phenotype. The experiment was performed twice.

Single nucleotide polymorphisms in the region of the CA6 gene were selected and genotyped on DNA isolated from whole stimulated saliva. The criteria for SNP selection were a) minor allele frequency (MAF) ≥ 5% in the CEU population b) not in complete linkage disequilibrium (r² ≤ 0.8) and c) in the 10,000 bp up-stream to 10,000 bp down-stream region of the CA6 gene. Using the NIH snptag resource (https://snpinfo.niehs.nih.gov/snpinfo/snptag.html) 30 SNPs met these criteria. Genotyping was performed using a multiplexed primer extension chemistry of the iPLEX assay with detection of the incorporated allele by mass spectrometry using a MassARRAY analyzer (Agena Bioscience, Hamburg, Germany). Raw data from the mass reader was converted to genotype data using the Typer software (Agena Bioscience)^{39 –41 (link)}. Two SNP markers had sample call rate 0%, rs2274333 and rs17032942, the reasons for the failure was low allele signals resulting in inaccurate genotype calls. An additional SNP (rs6697763) was excluded from analysis for deviation from Hardy-Weinberg equilibrium (p = 0.033), leaving 27 SNPs with valid genotype data, where the average call rate per sample was 99.4% and overall call rate was 99.8% (Table S1). Genotyping data are uploaded and available at figshare 10.6084/m9.figshare.6948020.