The largest database of trusted experimental protocols

Spleen dissociation medium

Manufactured by STEMCELL
Sourced in Canada

Spleen Dissociation Medium is a sterile, liquid culture medium designed for the dissociation and isolation of mouse and rat spleen cells. It contains enzymes and reagents that facilitate the mechanical and enzymatic disruption of spleen tissue to obtain a single-cell suspension.

Automatically generated - may contain errors

13 protocols using spleen dissociation medium

1

Isolation of Murine Dendritic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Spleens of untreated adult mice were digested using Spleen Dissociation Medium (Cat #07915, STEMCELL Technologies). Dendritic cells were isolated by positive selection from the using the EasySep Mouse CD11c Positive Selection Kit (Cat #18758, STEMCELL Technologies). These DC are CD11c positive and more than 90% of them express MHC-II and the costimulatory receptors CD80 and CD86.
+ Open protocol
+ Expand
2

Fluorescent Peptide and Nucleic Acid Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
SIINFEKL peptide (SIINFEKLRRRRRRRRR) was synthesized by Genscript with >98% purity, with a FITC tag on the N‐terminus. Trp2 peptide (SVYDFFVWLRRRRRRRRR) was synthesized by Genscript with a >98% purity, with or without a FITC tag on the N‐terminus. Alexa Fluor 405 NHS Ester (succinimidyl ester) was obtained from Thermo Fisher. PolyIC with a low molecular weight was purchased from Invivogen. CpG oligonucleotide (5′‐TCCATGACGTTCCTGACGTT‐3′) and ORN Sa19 oligonucleotide (5′‐GGACGGAAAGACCCCGUGG‐3′) were synthesized by IDT with a phosphorothioate backbone. LabelIT nucleic acid labeling kits (Cy5 and Cy5) were purchased from Mirus Bio LLC. 4′,6‐Diamidino‐2‐phenylindole (DAPI), wheat germ agglutinin Texas Red conjugate, and paraformaldehyde (4%) were from Life Technologies. CD11c+ positive isolation beads were from Miltenyi Biotec. EasySep mouse CD8+ isolation kits and spleen dissociation medium were from STEMCELL Technologies. Mouse INFγ, IL10, and IL‐6 ELISA kits, ELISA reagents including coating buffer, assay dilution, substrate and stop solution, anti‐mouse monoclonal antibodies for CD80 (APC), CD86 (PE‐Cy7), CD40 (PE), CD11c (APC‐Cy7, PE), B220 (PE‐Cy7), CD3 (APC‐Cy7), and CD8 (APC) were from BD Biosciences.
+ Open protocol
+ Expand
3

Isolation and Analysis of Murine T Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols
B6 and PWD mice were subjected to the dietary paradigms, as described in Section “Results.” At 5 weeks post-dietary intervention, mice were euthanized, and spleens were collected. Spleens were digested using Spleen Dissociation Medium (STEMCELL Technologies, Inc., Canada). B cells were depleted using the EasySep B cell positive selection kit and EasySep magnet (STEMCELL Technologies, Inc., Canada). The remaining cells were purified by FACS using fluorophore-conjugated antibodies against cell surface markers as follows: CD4 (Tconv) cells (CD19 TCRβ+ CD4+ CD8 CD25) and Tregs (CD19 TCRβ+ CD4+ CD8 CD25+). Dead cells were excluded using the Far Red Live-Dead staining kit (Thermo Fisher Scientific, USA). Antibodies were purchased from BioLegend, Inc. (San Diego, CA, USA); catalog numbers were as follows: CD19, CD4, CD25, CD8, CD11b, CD11c, and TCRβ; 115534, 100531, 102016, 101206, 117319, and 109222, respectively. RNA was isolated using the Qiagen RNeasy Mini or Micro Kits. RNA quality was assessed using the Agilent Bioanalyzer 2100, and samples were selected for downstream analysis based on RNA integrity number (typically 6–9). RNA quantity was determined using Qubit Fluorometric Quantification (Thermo Fisher Scientific, USA). Four biological replicates (individual mice) for each strain, sex, and diet combination were selected.
+ Open protocol
+ Expand
4

Isolation of Splenic Dendritic Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Spleens were collected from mice of all three groups, the uninfected control, E. hellem-infected and LPS treated. Isolation of DCs starts with mince the spleen into homogenous paste using commercially available Spleen Dissociation Medium (STEMCELL Technologies, Vancouver, Canada) in tissue culture dish, followed by gently passing several times through a 16 Gauge Blunt-End Needle attached to a 3 cc Syringe and then through a primed 70 μm nylon mesh filter. The filtered single cell suspension was then subjected to the EasySep Mouse Pan-DC Enrichment Kit (STEMCELL Technologies, Vancouver, Canada) to isolate dendritic cells only. This kit targets non-DCs for removal with biotinylated antibodies recognizing specific cell surface marker on unwanted cells in solution. Briefly, Enrichment Cocktail and Biotin Selection Cocktail, combinations of monoclonal antibodies, were added to the sample. Next, the samples were incubated with Streptavidin-bound magnetic particles to solution and a magnet was used to immunomagnetic negative selection of the dendritic cells. The purified DCs were then counted and cultured in RPMI Medium 1640 (supplemented with 10% FBS, 50 ng/mL GM-CFS (granulocyte-macrophage colony-stimulating factor) and penicillin/streptomycin) (Gibco, Waltham, MA, USA) in a 37 °C, 5% CO2 incubator.
+ Open protocol
+ Expand
5

Isolation of Primary Tumor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary cancer and adjacent normal tissues were obtained from consenting patients undergoing surgery with the approval of the University of Alberta Health Research Ethics Board. Samples were received in saline and processed within 2 h of surgery. Submucosal and necrotic tissues were stripped from the tumor tissue and the remaining tumor was processed in 4 ml of “spleen dissociation medium” (STEMCELL Technologies) using a GentleMACS dissociator (Miltenyi Biotec). After rocking at 37°C for 30 min, the suspension was reprocessed, EDTA was added to 10 mM, and the cells were incubated at room temperature for 10 min. The cells were centrifuged for 5 min at 350 g, washed, and plated in EpiLife medium (Thermo Fisher Scientific) supplemented with 25 μg/ml bovine pituitary extract, 0.5 ng/ml epidermal growth factor, 3 mM glycine, 0.1 mM MEM non‐essential amino acids, 1% ITS (insulin, transferrin, selenium), 2% FBS, 2 mM l‐glutamine, 100 U/ml penicillin, 100 U/ml streptomycin, and 0.25 μg/ml Fungizone® (Gibco).
+ Open protocol
+ Expand
6

SARS-CoV-2 Spike Protein RBD Trimer Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Zinc nitrate hexahydrate (228737, purity≥98%), 2-methylimidazole (M50850, purity ≥98.5 %), and gardiquimod (SML0877, purity≥98%) were purchased from Sigma-Aldrich. SARS-CoV-2 spike RBD trimer–histidine tag was purchased from Acro Biosystems (SPN-C52H9, purity ≥95%). Purified mRNAs were obtained from TriLink BioTechnologies. d-Luciferin and Bright-Glo reagent were purchased from Promega. All other reagents were purchased from Sigma-Aldrich.
Heptadecan-9-yl-8-{[2-hydroxyethyl][6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102) was purchased from Echelon, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and 1-2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) (Avanti, C14-PEG2000) were purchased from Avanti Polar Lipids. LysoTracker, Hoechst 33342, XenoLight DiR, and ProLong diamond antifade mountant were purchased from Thermo Fisher Scientific. Spleen dissociation medium was obtained from STEMCELL Technologies.
+ Open protocol
+ Expand
7

Isolating Immune Cells from Mouse Peyer's Patches

Check if the same lab product or an alternative is used in the 5 most similar protocols
Six-week old C3Hf/Sed/Kam mice were sacrificed and approximately 10 cm of the small intestine was harvested and placed in a 10 cm dish containing ice cold PBS + 1% Penicillin/Streptomycin (100 U/ml penicillin, 100 μg/ml streptomycin). The dish was then placed under a micro-dissection microscope to locate all the intestinal PPs in each mouse. PP domes were then dissected out of the intestines and finely chopped. Tissue suspensions were then poured into 4 mL of Spleen dissociation medium (Stem Cell Technologies, Vancouver, CA) and immune cells were isolated as per manufacturer’s protocol. Briefly, the PP cells were incubated in the medium for 30 minutes at room temperature rocking horizontally. PP fragments were dissociated in to a smooth suspension by gently squeezing each PP through a 70 μm mesh filter using the blunt end of a syringe. The immune cell suspension was then centrifuged at 300 x g for 10 minutes. The supernatant was discarded, and the cells were used for immune cell marker staining.
+ Open protocol
+ Expand
8

Lung Tissue Dissociation and Cell Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lung tissue was digested with spleen dissociation medium (Stemcell), and mechanically dissociated using a GentleMacs Dissociator (Miltenyi). Cells were then strained through a 70 μm filter and washed with Hanks’ Balanced Salt Solution supplemented with 10% foetal bovine serum (FBS) followed by red blood cell lysis. For adoptive transfer experiments, penicillin–streptomycin (Gibco) was added to media throughout the experiment.
+ Open protocol
+ Expand
9

Antigen-Adjuvant Peptide Formulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Peptides from ovalbumin (SIINFEKL, “SIIN”; SIINFEKL‐R9; “SIIN*”) were synthesized by GenScript. The peptides had a purity >98% and were synthesized with or without a fluorescein (FITC) label on the N‐terminus. PolyIC was purchased from Invivogen. CpG (5′ T‐C‐C‐A‐T‐G‐A‐C‐G‐T‐T‐C‐C‐T‐G‐A‐C‐G‐T‐T 3′) was synthesized by IDT. Gold(III) chloride trihydrate (99.9%) and chitosan (MW = 2000) were from Sigma. TE buffer was purchased from Amresco (Solon, OH). RPMI‐1640 media was purchased from Lonza (Allendale, NJ) and fetal bovine serum (FBS) was supplied by Corning (Tewksbury, MA). 2‐Mercaptoethanol was purchased from Sigma–Aldrich (St. Louis, MO). HEPES and non‐essential amino acids were purchased from VWR (Radnor, PA). L‐Glutamine, Penicillin‐Streptomycin, and DAPI were purchased from Thermo Fisher Scientific (Grand Island, NY). Spleen Dissociation Medium was from STEMCELL Technologies (Vancouver, British Columbia, Canada). CD11c microbeads were purchased from Miltenyi Biotec (Cambridge, MA). Fluorescent antibody conjugates were purchased from BD (San Jose, CA).
+ Open protocol
+ Expand
10

Murine Splenic Cell Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Spleens were harvested from 6 weeks-old C57BL/6 female mice dissected into 1 mm-sized portions and placed in commercially purchased Spleen Dissociation Medium (STEMCELL Technologies) for 30 min at 37°C and 5% CO2. Then the splenocytes were passed through a 70 μm filter, centrifuged at 200 × g for 5 min, and resuspended in HBSS +2% HI-FBS + 1 mM EDTA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!