Log In Sign up
The largest database of trusted experimental protocols

On target sirna oligos

Manufactured by Horizon Discovery
Visit Supplier

ON TARGET siRNA oligos are synthetic double-stranded RNA molecules designed to silence specific gene expression in cells. They are a core product offering from Horizon Discovery, a leading provider of gene editing and gene modulation tools.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (3 mentions) D 001810 01, by Horizon Discovery (1 mentions)

Spelling variants of this product

SiRNAs (161 citations) ON-TARGET (46 citations) SiRNA oligos (15 citations)

3 protocols using on target sirna oligos

1

Knockdown of Prenylation Genes Using siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were grown in live cell imaging compatible dish (Thermo Scientific #150682), and 10 cm dish formats. ON TARGET siRNA oligos from Dharmacon, Inc.2d for various genes (PTAR1, PGGT1B, FNTA, and RabGGTA) and controls were used at 5 nM final concentration for 24–72 hours using Lipofectamine® RNAimax reagent, according to the manufacturer’s instruction (invitrogen). ON-TARGETplus human PTAR1 siRNA (L-010311–01, LU-010311-01, J-010311-09-0005, J-010311-10-0002): GAAGCUAGGUAUAACCGGA, GAACAGGAGAUGAAUUGAUA, CCAUAGUCCUGGUUGAAAA, GGAGGAACCCACACAUAGA. ON-TARGETplus human FNTA siRNA (L-008807, LU-008807), ON-TARGETplus human RABGGTA siRNA (L-005097), ON-TARGETplus human PGGT1B (L-008703-00-0005) and ON-TARGET Non-targeting siRNA #1 (D-001810-01-05).
Kuchay S., Wang H., Marzio A., Jain K., Homer H., Fehrenbacher N., Philips M.R., Zheng N, & Pagano M. (2019). GGTase3 is a Newly Identified Geranylgeranyltransferase Targeting a Ubiquitin Ligase. Nature structural & molecular biology, 26(7), 628-636.
+ Open protocol
+ Expand
2

Knockdown of Prenylation Genes Using siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were grown in live cell imaging compatible dish (Thermo Scientific #150682), and 10 cm dish formats. ON TARGET siRNA oligos from Dharmacon, Inc.2d for various genes (PTAR1, PGGT1B, FNTA, and RabGGTA) and controls were used at 5 nM final concentration for 24–72 hours using Lipofectamine® RNAimax reagent, according to the manufacturer’s instruction (invitrogen). ON-TARGETplus human PTAR1 siRNA (L-010311–01, LU-010311-01, J-010311-09-0005, J-010311-10-0002): GAAGCUAGGUAUAACCGGA, GAACAGGAGAUGAAUUGAUA, CCAUAGUCCUGGUUGAAAA, GGAGGAACCCACACAUAGA. ON-TARGETplus human FNTA siRNA (L-008807, LU-008807), ON-TARGETplus human RABGGTA siRNA (L-005097), ON-TARGETplus human PGGT1B (L-008703-00-0005) and ON-TARGET Non-targeting siRNA #1 (D-001810-01-05).
Kuchay S., Wang H., Marzio A., Jain K., Homer H., Fehrenbacher N., Philips M.R., Zheng N, & Pagano M. (2019). GGTase3 is a Newly Identified Geranylgeranyltransferase Targeting a Ubiquitin Ligase. Nature structural & molecular biology, 26(7), 628-636.
+ Open protocol
+ Expand
3

Knockdown of ESR1, FOXA1, and CASZ1 in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF7 and MDA134 cells were seeded in 6- or 24-well plates and transfected with 20nM siRNA oligos by Lipofectamine RNAiMax reagent (Life Technology). Knockdown efficiency was determined after 72 hours of transfection. Cell counting was performed after 3 and 7 days of transfection. The ON-TARGET siRNA oligos targeting ESR1 (LQ-003401–00), FOXA1 (J-010319–05 and J-010319–06), CASZ1 (LQ-020764–02) or non-targeting control (D-001810–01) were all purchased from Dharmacon.
Nardone A., Qiu X., Spisak S., Nagy Z., Feiglin A., Feit A., Cohen Feit G., Xie Y., Font-Tello A., Guarducci C., Hermida-Prado F., Syamala S., Lim K., Munoz Gomez M., Pun M., Cornwell M., Liu W., Ors A., Mohammed H., Cejas P., Brock J.B., Freedman M.L., Winer E.P., Fu X., Schiff R., Long H.W., Metzger Filho O, & Jeselsohn R. (2022). A Distinct Chromatin State Drives Therapeutic Resistance in Invasive Lobular Breast Cancer. Cancer research, 82(20), 3673-3686.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!