The mouse FLAG antibody and resin were from Sigma-Aldrich (St. Louis, MO), mouse GFP antibody was from Santa Cruz Biotechnology (Santa Cruz, CA), and the mouse E-cadherin antibody was from BD Biosciences (Mississauga, Canada). The rabbit antisera and affinity-purified antibodies against full-length human ezrin have been described (Bretscher, 1989 (link)). The anti-Cobl antibody was a kind gift from J. Klingensmith (Duke University, Durham, NC). Goat anti-mouse secondary antibodies conjugated to horseradish peroxidase were from Jackson ImmunoResearch Laboratories (West Grove, PA). Alexa Fluor 568– and Alexa Flour 660–conjugated donkey anti-rabbit antibodies and Alexa Fluor 660–conjugated phalloidin were from Invitrogen (Carlsbad, CA). IRDye 680– and 800–conjugated secondary antibodies were from LI-COR Biosciences (Lincoln, NE). WGA-488 was from Molecular Probes (Lafayette, CO).
Irdye 680 and 800 conjugated secondary antibodies
Manufactured by LI COR
IRDye 680- and 800-conjugated secondary antibodies are fluorescent labeling reagents designed for detection and quantification in Western blotting, ELISA, and other immunoassay applications. These antibodies are conjugated with near-infrared fluorescent dyes that provide high sensitivity and a wide dynamic range for accurate target protein measurement.
Automatically generated - may contain errors
Lab products found in correlation
Wga 488, by Thermo Fisher Scientific (1 mentions)
3h cholesterol, by PerkinElmer (1 mentions)
Odyssey blocking buffer, by LI COR (1 mentions)
Cholesterol, by Avanti Polar Lipids (1 mentions)
Egg yolk phosphatidylcholine, by Avanti Polar Lipids (1 mentions)
Egg yolk phosphatidyl ethanolamine, by Avanti Polar Lipids (1 mentions)
2 protocols using irdye 680 and 800 conjugated secondary antibodies
1
Antibody Sources and Characterization
2
Lipid Reagents for PI-4P Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Egg yolk phosphatidylcholine (PC), porcine brain PS, egg yolk phosphatidylethanolamine (PE), 1,2-dioleoyl lactosyl-PE, 1,2-dioleoyl dansyl–PE, porcine brain PI-4P, cholesterol and DHE were purchased from Avanti Polar lipids (Alabaster, AL). CTL was prepared as previously described [24] (link). The anti-PI-4P mouse monoclonal antibody was purchased from Echelon Biosciences (Salt Lake City UT). [3H]cholesterol and [32P]PO4 were purchased from Perkin-Elmer (Waltham, MA). ON-TARGETplus human OSBPL9 siRNAs were purchased from Dharmacon (Lafayette, CO). Odyssey blocking buffer and IRDye 680- and 800-conjugated secondary antibodies were obtained from LI-COR Biosciences (Lincoln, NE). Preparation of the rabbit anti-ORP9 antibody was previously described [25] (link). pENTR/D-ORP9L-HH488,489AA and pcDNA-ORP9L- HH488,489AA (ORP9L-HH/AA) were made by mutagenesis of the respective wild-type vectors (QuikChange II XL site-direct mutagenesis kit, Stratagene, La Jolla, CA) using forward and reverse primers (GCTGAGCAGGTTTCCGCTGCTCCACCCATTTCAGCC and GGCTGAAATGGGTGG AGCAGCGGAAACCTGCTCAGC , Integrated DNA Technologies, Coralville, IA) and verified by sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!