The largest database of trusted experimental protocols

Maxime pcr premix kit

Manufactured by iNtRON Biotechnology
Sourced in Germany, United States

The Maxime PCR PreMix Kit is a ready-to-use solution for performing polymerase chain reaction (PCR) experiments. It contains all the necessary components, including the DNA polymerase, buffer, and nucleotides, pre-mixed and optimized for efficient PCR amplification.

Automatically generated - may contain errors

34 protocols using maxime pcr premix kit

1

Multiplex PCR for Microbial Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR was carried out in a 20 µl volume using the Maxime PCR PreMix kit (iNtRON Biotechnology, Seongnam, Korea), 1 µl of each forward and reverse primer (10 pmol/µL), 2 µl of DNA, and then the volume was completed to 20 µl by distilled water. Four multiplex and single reaction PCR protocols were used for ampli cation of 16S rRNA, resistant and virulence genes, the initial melting temperature for all was 95 °C for 5 minutes and a nal extension was at 72 °C for 10 minutes. Details of annealing temperatures are listed in Table 1.
+ Open protocol
+ Expand
2

Multiplex PCR for Microbial Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR was carried out in a 20μl volume using the Maxime PCR PreMix kit (iNtRON Biotechnology, Seongnam, Korea), 1μl of each forward and reverse primer (10 pmol/μL), 2 μl of DNA, and then the volume was completed to 20 μl by distilled water. Four multiplex and single reaction PCR protocols were used for ampli cation of 16S rRNA, resistant and virulence genes, the initial melting temperature for all was 95°C for 5 minutes and a nal extension was at 72°C for 10 minutes. Details of annealing temperatures are listed in Table 1.
+ Open protocol
+ Expand
3

Multiplex PCR Detection of Foodborne Pathogens

Check if the same lab product or an alternative is used in the 5 most similar protocols
A set of primers were used to detect the Escherichia coli O157: H7 verocytotoxin stx gene, the Listeria. monocytogenes hemolysin hly gene, the Salmonella spp. invasion invA gene, the Vibrio cholerae toxin ctx gene, the Vibrio parahaemolyticus thermolabile hemolysin tlh gene, the S. aureus thermostable nuclease (nuc) gene (Lei et al., 2008 ) (Table 1).

Primer sequences and expected size of PCR-amplified gene targets of six species of foodborne pathogens (Lei et al., 2008 ).

PathogenPrimer nameDNA sequence (5ʼ to 3ʼ)Amplicons size (bp)
V. choleraectxAB _FctxAB _RTGAAATAAAGCAGTCAGGTGGGTATTCTGCACACAAATCAG777
E. colistx_Fstx_RTGGGTTTTTCTTCGGTATCCCCAGTTCAGAGTGAGGTCCA632
Salmonella spp.invA_FinvA_RTACTAACAGTGCTCGTTTACATAAACTTCATCGCACCGTCA570
V. parahaemolyticustlh_Ftlh_RCGGATTATGCAGAAGCACTG ACTTTCTAGCATTTTCTCTGC444
S. aureusnuc_Fnuc_RGCGATTGATGGTGATACGGTTAGCCAAGCCTTGACGAACTAAAGC270
L. monocytogeneshly_Fhly_RGCATCTGCATTCAATAAAGATGTCACTGCATCTCCGTGGT174
The Maxime PCR Pre-Mix kit was used to perform multiplex PCR in a 25 μl volume (iNtRON Biotechnology, Seongnam, Korea). The premix was dissolved in 16 μl of Distilled Water and transferred into a 0.2 ml PCR tube. For each tube, 0.6 μl of each primer and 2 μl of DNA were added.
+ Open protocol
+ Expand
4

Mouse Liver RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse liver RNA was extracted by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA was reverse transcribed with the Maxime PCR premix Kit (iNtRON Biotechnology, Seongnam, Korea). Quantitative RT-PCR using SYBR Green 2× master mix kit (m.biotech., Inc., Seoul, Korea) was run in hexaplicate on a CFX96 Touch real-Time PCR Detection System (Bio-Rad, Hercrules, CA, USA). The 18s was used for the relative quantization of the target genes based on the comparative ∆∆ threshold cycle (Ct) method, as previously described [26 (link)]. Primer sequences are shown in Table 2.
+ Open protocol
+ Expand
5

Multiplex PCR for Detecting Resistance and Virulence

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR was carried out in a 20 µl volume using the Maxime PCR PreMix kit (iNtRON Biotechnology, Seongnam, Korea), 1 µl of each forward and reverse primer (10 pmol/µL), 2 µl of DNA, and then the volume was completed to 20 µl by distilled water. Four multiplex and single reaction PCR protocols were used for ampli cation of 16S rRNA, resistant and virulence genes, the initial melting temperature for all was 95 °C for 5 minutes and a nal extension was at 72 °C for 10 minutes. Details of annealing temperatures are listed in Table (1) .
+ Open protocol
+ Expand
6

Bacterial Colony PCR Amplification and Phylogenetic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bacteria colony PCR amplification was performed using a Maxime PCR PreMix kit (iNtRON Biotechnology, Korea). The PCR mixture contained 1.0 μl of each of the 27F and 1492R primers [28 (link)], 1.0 μl diluted bacterial isolates, and 22.0 μl distilled water. Thermal cycling consisted of 95°C for 10 min, and 35 cycles of 95°C for 40 sec, 55°C for 40 sec, 72°C for 60 sec, and then incubation at 72°C for 5 min. The PCR products were electrophoresed through a 1% agarose gel and purified using ExpinTM PCR Purification Kits (GeneAll Biotechnology, Korea) following the manufacturer’s instructions. Purified PCR products were sequenced using an ABI3700 automated DNA sequencer at Macrogen (Seoul, Korea). The sequences were aligned using MAFFT [29 (link)] and edited manually with MEGA v.5.0 [30 (link)]. Phylogenetic trees were constructed using the neighbor-joining method with 1000 bootstrap replications. Reference sequences were retrieved from the EzBioCloud database [31 (link)]. Based on species identification, the number of species were compared between each part using Kruskal-Wallis rank sum test and Dunn’s test as a post hoc test adjusted by the false discovery rate of Benjamini and Hochberg [32 ]. Sequences generated from the study were deposited in Genbank under accession numbers KY992547-KY992562.
+ Open protocol
+ Expand
7

Molecular Characterization of Laccase Genes in Lentinula edodes

Check if the same lab product or an alternative is used in the 5 most similar protocols
L. edodes was grown in PDB for 14 days at 25℃. Mycelia were frozen in liquid nitrogen and ground with a mortar and pestle. Genomic DNA was extracted from the mycelial powder using Genomic DNA Prep Kit (BIOFACT Co., Daejeon, Korea). Genomic DNA was subjected to PCR for the amplification of laccase genes using primer sets shown in Table 1. PCR was performed using a PCR premix (Maxime PCR premix kit, iNtRON Biotechnology, Eumseong, Korea) with following conditions: 94℃ for 5 min, followed by 25 cycles of 94℃ for 30 sec, 57℃ for 30 sec, and 72℃ for 1 min, and final 72℃ for 10 min. The amplified DNA bands were cloned using a TA cloning kit (pGEM-Teasy vector, Promega, Madison, WI, USA) and their sequences were determined.
For analysis of mRNA sequence variations, total RNA was extracted from the mycelial powder aforementioned using an RNA extraction kit (RNA-spin, iNtRON Biotechnology) Reverse transcription PCR (RT-PCR) was performed using one step RT-PCR kit (Maxime RT-PCR premix kit; iNtRON Biotechnology) with the primer sets listed in Table 1. The amplified cDNAs were cloned into a TA vector (pGEM-T Easy vector, Promega) for sequence analysis.
+ Open protocol
+ Expand
8

RNA Extraction and CVB3 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the ovary with an Easy-BLUE total RNA extraction
kit (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer’s instructions.
cDNA synthesis and PCR was performed using a Maxime PCR PreMix kit (iNtRON Biotechnology).
Primer sequences for CVB3 (GenBank no. M16572) were as follows: sense 5′-ccc cgg act gag
tat caa ta-3′(position 180–199) and antisense 5′-gca gtt agg att agc cgc at-3′ (postion
460–479). Primers for β-actin (GenBank no. BC138611) were as follows: sense 5′-act ctt cca
gcc ttc ctt c-3′ (position 830–844) and antisense 5′-atc tcc ttc tgc atc ctg tc −3′
(postion 977–996). After amplification, the PCR products were separated on a 1.5% agarose
gel containing RedSafe (iNtRON Biotechnology).
+ Open protocol
+ Expand
9

Total RNA Extraction and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Extraction of total cellular RNA was performed using an RNeasy mini kit (Cat. no. 74106, Qiagen, CA). Reverse transcription of total RNA (1 µg) was performed using SuperScript II reverse transcriptase (Cat. no. 18064, Invitrogen) and an oligo (dT) primer (Cat. no. 18418012, Invitrogen). One-tenth of the cDNA from the first-strand reaction was amplified using a Maxime PCR premix kit (Cat. no. 25167, iNtRON Biotechnology). The PCR primers used for detection of mRNA levels are shown in Supplementary Table S2.
+ Open protocol
+ Expand
10

Quantification of P2X7 gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from MCF-7 and TAMR-MCF-7 cells using TRIzol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s protocol. 1 μg total RNA was reverse-transcribed using Maxime RT-PreMix Kit (Intron biotechnology, Gyeonggi-do, Korea) to synthesize cDNA, and the obtained cDNA was amplified by PCR using a Maxime PCR PreMix Kit (Intron biotechnology, Gyeonggi-do, Korea) and electrophoresed on 2% agarose gel. Detailed primer sequences used in the experiments are provided as Supplementary Information (Supplementary Table S1). Quantitative polymerase chain reaction was carried out using SYBR green (biorad, San Francisco, CA) incorporation with gene-specific primers. The forward primer for P2X7 was: 5′- TATGAGACGAACAAAGTCACTCG-3′ and the reverse one was: 5′- GCAAAGCAAACGTAGGAAAAGAT-3′. The primers for 18 S were: forward: 5′- CCATCCAATCGGTAGTAGCG-3′; reverse: 5′- GTAACCCGTTGAACCCCATT-3′. Relative gene expression was calculated by ΔΔCt analysis relative to 18 S.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!