Maxime pcr premix kit
The Maxime PCR PreMix Kit is a ready-to-use solution for performing polymerase chain reaction (PCR) experiments. It contains all the necessary components, including the DNA polymerase, buffer, and nucleotides, pre-mixed and optimized for efficient PCR amplification.
Lab products found in correlation
34 protocols using maxime pcr premix kit
Multiplex PCR for Microbial Profiling
Multiplex PCR for Microbial Identification
Multiplex PCR Detection of Foodborne Pathogens
Primer sequences and expected size of PCR-amplified gene targets of six species of foodborne pathogens (Lei et al., 2008 ).
Pathogen | Primer name | DNA sequence (5ʼ to 3ʼ) | Amplicons size (bp) |
---|---|---|---|
V. cholerae | ctxAB _F | TGAAATAAAGCAGTCAGGTG | 777 |
E. coli | stx_F | TGGGTTTTTCTTCGGTATCC | 632 |
Salmonella spp. | invA_F | TACTAACAGTGCTCGTTTAC | 570 |
V. parahaemolyticus | tlh_F | CGGATTATGCAGAAGCACTG ACTTTCTAGCATTTTCTCTGC | 444 |
S. aureus | nuc_F | GCGATTGATGGTGATACGGTT | 270 |
L. monocytogenes | hly_F | GCATCTGCATTCAATAAAGA | 174 |
Mouse Liver RNA Extraction and qRT-PCR
Multiplex PCR for Detecting Resistance and Virulence
Bacterial Colony PCR Amplification and Phylogenetic Analysis
Molecular Characterization of Laccase Genes in Lentinula edodes
For analysis of mRNA sequence variations, total RNA was extracted from the mycelial powder aforementioned using an RNA extraction kit (RNA-spin, iNtRON Biotechnology) Reverse transcription PCR (RT-PCR) was performed using one step RT-PCR kit (Maxime RT-PCR premix kit; iNtRON Biotechnology) with the primer sets listed in
RNA Extraction and CVB3 Gene Expression
kit (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer’s instructions.
cDNA synthesis and PCR was performed using a Maxime PCR PreMix kit (iNtRON Biotechnology).
Primer sequences for CVB3 (GenBank no. M16572) were as follows: sense 5′-ccc cgg act gag
tat caa ta-3′(position 180–199) and antisense 5′-gca gtt agg att agc cgc at-3′ (postion
460–479). Primers for β-actin (GenBank no. BC138611) were as follows: sense 5′-act ctt cca
gcc ttc ctt c-3′ (position 830–844) and antisense 5′-atc tcc ttc tgc atc ctg tc −3′
(postion 977–996). After amplification, the PCR products were separated on a 1.5% agarose
gel containing RedSafe™ (iNtRON Biotechnology).
Total RNA Extraction and RT-PCR
Quantification of P2X7 gene expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!