Pli 100 picolitre injector

Manufactured by Harvard Apparatus

The PLI-100 Picolitre Injector is a laboratory instrument designed for the precise delivery of small liquid volumes, typically in the picolitre range. It is a highly specialized tool used in various scientific applications that require the controlled and accurate dispensing of minute amounts of liquids.

Automatically generated - may contain errors

Lab products found in correlation

Control mo, by Gene Tools (1 mentions)

4 protocols using pli 100 picolitre injector

Zebrafish Knockdown Using Morpholinos

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed MO for in vivo knockdown of the zebrafish dspa, dspb and lmna (Gene Tools). MO sequences targeting the zebrafish dspa-201 ENSDART00000148460.4 transcript translation start site was: 5′-GGTCTGAGAACCGGACAAACTCATC-3′, and for the dspb-201 ENSDART00000111078.4 transcript, targeting its exon4 -intron4 boundary was 5’-TCTGACTGTGTTTCAGACTGACCTG-3′. For the zebrafish lmna-204 ENSDART00000184045.1 transcript, we used translation blocking MO: 5′- CATGGTTGTCTGGAACTACTGATAA-3′. The control mispair MO sequence was: 5′-CCTCTTACCTCAGTTACAATTTATA-3′. Microinjection of 1–2 nL was performed into single-cell zebrafish embryo using PLI-100 Picolitre injector, Harvard Apparatus as described previously (60 (link)).

Elfatih A., Da’as S.I., Abdelrahman D., Mbarek H., Mohammed I., Hasan W., Fakhro K.A., Estivill X, & Mifsud B. (2022). Analysis of incidental findings in Qatar genome participants reveals novel functional variants in LMNA and DSP. Human Molecular Genetics, 31(16), 2796-2809.

+ Open protocol

+ Expand

Knockdown of Zebrafish F8 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ZF F8 protein shares 30.5% identity (51.3% similarity) in a 2361 amino acid overlap with human FVIII. The morpholino oligomer (MO) sequence, which blocks protein translation, was designed to knock down the expression of endogenous F8. A standard control MO (Control-MO, Gene Tools) was used as a negative control. The MO sequences were as follows: 5′-TTTACAATATCCTCACTCACTGTGC-3′ (f8-MO) and 5′-CCTCTTACCTCAGTTACAATTTATA-3′ (Control-MO). ZF were microinjected with MO diluted to concentrations of 0.5, 0.75, and 1.00 mM at the 1-cell stage or at 48 hours after fertilization using a PLI-100 Picolitre injector (Harvard Apparatus), as previously described.¹⁹

Elnaggar M., Al-Mohannadi A., Hasan W., Abdelrahman D., Al-Kubaisi M.J., Pavlovski I., Gentilcore G., Sathappan A., Kizhakayil D., Ali A.I., Mohan S., Olagunju D., Cugno C., Grivel J.C., Borsotti C., Follenzi A., Da’as S.I, & Deola S. (2022). CD14+/CD31+ monocytes expanded by UM171 correct hemophilia A in zebrafish upon lentiviral gene transfer of factor VIII. Blood Advances, 7(5), 697-711.

+ Open protocol

+ Expand

Zebrafish model for MYO6 variant

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The myo6a morpholino (MO, 5′ CACCGGCTTTCCATCGTCCATTTCA 3′, Gene Tools, Philomath, OR, USA) targeted against the translational start site was injected into embryos at the one-cell stage to knock down endogenous zebrafish myo6a. MO antisense oligos were dissolved to a final concentration of 2.0 µM. Injections were performed at the one-cell stage using PLI-100 Picolitre injector, Harvard Apparatus, as described previously [37 (link)]. Embryos at the 1–2-cell stage were injected with 50 ng of ATG morpholinos to knock down endogenous zebrafish and to generate null zebrafish (ZF_myo6a_MO). The ZF_MYO6_MO model was rescued with co-injections of synthetic human MYO6 RNA of the wild type (MYO6^W^T) and the variant (MYO6^p.E60Q).

Alkowari M., Espino-Guarch M., Daas S., Abdelrahman D., Hasan W., Krishnamoorthy N., Sathappan A., Sheehan P., Van Panhuys N, & Estivill X. (2022). Functional Characterization of the MYO6 Variant p.E60Q in Non-Syndromic Hearing Loss Patients. International Journal of Molecular Sciences, 23(6), 3369.

+ Open protocol

+ Expand

Zebrafish pgap3 Gene Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Translational blocking Morpholino (MO) sequence designed to target the Zebrafish NM_001114591.1 was synthesized by Gene Tools (Corvallis, OR, USA). Zebrafish pgap3-MO was designed targeting the ATG start codon of transcripts ENSDART00000091519.4 and ENSDART00000152737.3. MO antisense oligos were dissolved to a final concentration of 2.0 µM. Injections were performed at the 1-cell stage using a PLI-100 Picolitre injector, Harvard Apparatus, as described previously. Optimal doses for the MO were 3, 4.5, and 6 ng. At 24 hpf, the embryos were visualized using a stereomicroscope (Zeiss). To confirm the specificity of the effects of the pgap3 MO, a second P53 morpholino (p53 MO) was co-injected. For this experiment, the dosage of injected P53 MO was 3.0 ng. Sequences of the pgap3 MO were MO: 5′GGCCGCGAGAAACATCAGGCCATTA3′-FITC, Standard Control MO: 5′ CCTCTTACCTCAGTTACAATTTATA3′-FITC, p53 MO: 5′ GCGCCATTGCTTTGCAAGAATTG3′.

Da’as S.I., Aamer W., Hasan W., Al-Maraghi A., Al-Kurbi A., Kilani H., AlRayahi J., Zamel K., Stotland M.A, & Fakhro K.A. (2020). PGAP3 Associated with Hyperphosphatasia with Mental Retardation Plays a Novel Role in Brain Morphogenesis and Neuronal Wiring at Early Development. Cells, 9(8), 1782.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!