Ni nta sefinose column

The arsR^M gene was amplified by PCR using arsR^M-His-F/R as primers (Table S2) and the genomic DNA of M20 as the template. The purified arsR^M fragment was cloned into pMD18-T and verified by sequencing. NdeI and XhoI were used to digest the recombinant plasmid. The arsR^M gene fragment was then inserted into digested pET-15b. The resulting plasmid, pET-arsRM, was transformed into Escherichia coli BL21 (DE3), to produce E. coli strain ARM3 (Table S1). When the E. coli ARM3 culture reached an OD_{600 nm} of 0.6, 1.0 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) was added to induce the expression of the His-tagged ArsR^M fusion protein. After incubation at 28°C for 4 h, the His-tagged ArsR^M was purified using a Ni-NTA-Sefinose column (Sangon Biotech Co., Shanghai, China) and then analyzed by 10% SDS-PAGE as previously described [28 (link)].

The expression and purification of recombinant truncate IL-8 was conducted as described in our previous study57 (link). Briefly, the plasmid T-tIL-8 was digested with EcoRI and XhoI and the resultant products were inserted into the EcoRI/XhoI-digested pET32a (+) vector to construct the recombinant expression plasmid, named as P-tIL-8. The plasmid was then transformed into E. coli BL21 and induced by adding 1.0 mM IPTG at 37 °C for 4 h. the cells were centrifuged at 8000× g for 10 min at 4 °C and suspended with sterile phosphate buffer saline (PBS), followed by ultrasonicating with an ultrasonic cell disrupter (JY92-IIDN, Ningbo Scientz, China) and examined by 12.5% SDS-PAGE. The inclusion bodies from the insoluble fractions were purified by Ni-NTA-Sefinose Column (Sangon Biotech, Shanghai, China) after dissolution in 8 M urea solutions and filtration with 0.22-μm filters. The refolding of the purified proteins was conducted by dialyzing gradiently from 6 M urea solutions to PBS at 4 °C, and then analyzed by 12.5% SDS-PAGE. The protein was quantified using the Bradford assay with bovine serum albumin (BSA) as standard and a NanoDrop spectrophotometer (Thermo Scientific) according to the manufacturer’s instructions. Purified proteins were named as rtIL-8 and stored at 20 °C.

The ORFs of Scpdo and SccsoR were amplified from S. coelicolor M145 genomic DNA. ScCsoR mutants were constructed using the revised QuikChange™ method (Xia et al., 2015). The ORFs were ligated into pET15b plasmid (Table S2) for expression. E. coli BL21(DE3) cells containing pET15b derived plasmids were cultured in LB medium at 37 °C until OD_600nm reached about 0.5, and then 0.5 mM isopropyl β‐D‐1‐thiogalactopyranoside (IPTG) was added. The temperature was changed to 30 °C, and the cultivation was continued overnight. Cells were harvested by centrifugation and disrupted using a pressure cell homogenizer (SPCH‐18) at 4 °C in buffer I (50 mM NaH₂PO₄, 250 mM NaCl, 20 mM imidazole, pH 8.0). The His‐tagged protein was purified using Ni‐NTA‐Sefinose column (Sangon) following the manufacturer’s instructions. The purity of the protein was examined using SDS‐PAGE, and its concentration was determined using a bicinchoninic acid assay.

DNA probes labeled with biotin were synthesized by BioSune Biotech. The sequence of the DNA region in the miR146a intergenic region that was recognized and bound by NDR1 contained biotin: biotin-miR146a intergenic A–F (biotin-AAGAATCCTGAGATACAATCAAAAAAACAA), miR146a intergenic A–R (TTGTTTTTTTGATTGTATCTCAGGATTCTT), biotin-miR146a intergenic B–F (biotin-TTGGCGGGCCGCAGACAACCGGCCACCATC), miR146a intergenic B–F–R (GATGGTGGCCGGTTGTCTGCGGCCCGCCAA), biotin-DNA negative control-F (biotin-AGGGCTCCTCATGCCTGGGATTGGGGTTTC), and biotin-DNA negative control-R (GAAACCCCAATCCCAGGCATGAGGAGCCCT). Single strands of DNA were thermally annealed to form dsDNA prior to pull-down experiments. Myc-NDR1-his was transiently overexpressed in HEK293 cells and purified using a Ni-NTA-Sefinose column (Sangon Biotech) according to the manufacturer’s protocol. Then, the myc-NDR1-his protein in DNA pull-down buffer (10 mM HEPES, 150 mM NaCl, 1 mM MgCl₂, 0.5 mM EDTA, 0.5 mM DTT, 0.1% (vol/vol) NP40, and 10% (vol/vol) glycerol) or a cell lysate was mixed with the biotinylated DNA probe and incubated for 30 min at 25 °C. Streptavidin Sepharose beads (Thermo) were then added, and samples were incubated for another 30 min. The beads were washed three times with DNA pull-down buffer and resolved via SDS-PAGE with 2× SDS loading buffer, then subjected to immunoblotting.

To construct the AdpA expression strain, the coding sequence of adpA was amplified from WT genomic DNA with the primers ExadpA-F/R. The PCR product was purified and ligated into the pET15b vector with a C-terminal His tag to create plasmid pET-AdpA by using the ClonExpress II one-step cloning kit (TaKaRa). The plasmid was transformed into E. coli BL21(DE3) cells, which were grown in LB medium at 37°C to an optical density at 600 nm (OD₆₀₀) of 0.6, and then a total of 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) was added and an additional overnight cultivation was continued at 16°C. Cultures were collected by centrifugation and disrupted though a pressure cell homogenizer (SPCH-18) in sonication buffer (50 mM NaH₂PO₄, 250 mM NaCl, 20 mM imidazole, pH 8.0); 1 mM DTT was added before breaking the cells. Purification of the AdpA His-tagged proteins was performed with a Ni-NTA-Sefinose column (Sangon) as described previously (24 (link)). The protein purification process was conducted in an anaerobic glove box, which was filled with mixed gas (N₂, 85%; H₂, 10%; CO₂, 5%). The purity of the protein was assessed by SDS-PAGE gel, and its concentration was determined using the bicinchoninic acid (BCA) protein assay reagent (Thermo Fisher Scientific). The same method was used for purification of AdpA mutants.

Positive clones were incubated in a 5 mL LB broth medium containing 50 μg/mL Kana at 37 °C overnight. Subsequently, the solution was transferred to a 200 mL LB broth medium containing 50 μg/mL Kana with 1% (v/v) volume and incubated at 37 °C. When the OD₆₀₀ reached 0.6–0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM to induce the expression of recombinant enzymes. After being cultured at 16 °C for 20 h, the cells were harvested by centrifugation (4 °C, 10,000× g, 20 min) and resuspended in potassium phosphate buffer (50 mM NaH₂PO₄ and 300 mM NaCl, pH 8.0). Then the cells were disrupted by sonication (SCIENTZ-IID, SCIENTZ, Ningbo, China), and the supernatant was collected as a crude enzyme by centrifugation (4 °C, 12,000× g, 20 min). The crude enzymes were purified by Ni-NTA-Sefinose column (Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions. The concentrations of purified enzymes were determined by a Micro-Volume UV–Vis spectrophotometer (NanoDrop, Thermo Scientific Co., Ltd., Waltham, MA, USA), and the molecular masses were determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).