Block it pol 2 mir rnai expression vector kit with emgfp

The shTMEM230 sequence (for down regulation of endogenous TMEM230) was cloned into pcDNA™6.2-GW/EmGFP using the BLOCK-iT™ Pol II miR RNAi Expression Vector Kit with EmGFP (Thermo Fisher Scientific K493600) following the manufacturer’s instruction. The following sequences were annealed to generate double stranded oligonucleotides:
TOP:5′-TGCTGTGTAGGTTCACTTAACATCTTgttttggccact gactgacAAGATGTTGTGAACCTACA-3′ and
BOTTOM:5′-cctgTGTAGGTTCACAACATCTTgtcagtcagtgg ccaaaacAAGATGTTAAGTGAACCTACAC-3′. Capital letters represent the sense and anti-sense sequences of the small hairpin RNA to be expressed for targeting the endogenous TMEM230 transcript. Small letters are the sequence forming the loop of the hairpin structure. The expression cassette of the resulting plasmid and the control vector provided in the kit (pcDNA™6.2-GW/EmGFP-miR-neg Control) were amplified by PCR using the following primers: FW 5′-GGCATGGACGAGCTGTACAA-3′ and RVNotI 5′-GTGCGGCCGCATCTGGGCCATTT-3′ (which added a NotI restriction site). The PCR product was cloned into the destination lentiviral vector pCDH-CMV-MCS-EF1-copGFP (SBI CD511B1), between BamHI and NotI restriction sites.

Transfection and electroporation experiments were preformed with the following constructs. pmiRZIP lentivector (ZIP NULL), pmiRZIP lentivector anti-miRNA-206 (ZIP-206), and pmiRZIP lentivector anti-miRNA-21(ZIP-21) were acquired from System Bioscience. pMIR206-Luc and pMIR21-Luc were acquired from Signosis BioSignal. Renilla Null and Renilla TK were acquired from Promega (pRL-null number E2271, pRL-TK number E2241).
The mature sequences of miRNA-206 and miRNA-21 were cloned into the BLOCK-iT Pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen number K4936-00). The oligos used are shown in Table 2. As negative control the pcDNA6.2-GW/EmGFP-miR-neg control was used, according to manufacturer's instructions.
The 3′UTR of the different analyzed genes was cloned from muscle cDNA into the pMIR-LUC vector (Signosis BioSignal). The sequence of the oligonucleotide primers used to clone the 3′UTR of each gene are shown in Table 2. All constructs were sequenced to confirm the insert and absence of mutation.
To mutate the 3′UTR of YY1 and eIF4E3 the QuikChangeII site-directed Mutagenesis Kit (Stratagene number 200524) was used according to the manufacturer's instructions. The primers used for the mutagenesis are shown in Table 3. All mutated constructs were sequenced to confirm the presence of the desired mutations and the absence of other unspecific mutations.

Four potential miRNAs were developed from the complete IRES nucleotide sequence of FMDV O/HN/CHA/93 strain by using the miRNA design tool on Invitrogen’s web site tool (http://rnaidesigner.invitrogen.com/rnaiexpress/, Table 1). Oligonucleotides of the pre-miRNAs forward and reverse strands were synthesized, annealed, and cloned into pcDNA™6.2-GW/miR vector (Invitrogen) under the control of P_CMV and a transcriptional termination signal (TK pA), following the manufacturer’s protocol. These plasmids were designated pmiR153, pmiR220, pmiR242, and pmiR276 (Figure 1A). For subcloning, BamH I/Xho I digested products from pmiR276 were inserted into pmiR242 at its Bgl II/Xho I sites, resulting in pmiR242 + 276, a Dual-miRNA plasmid containing two IRES-specific miRNA hairpin structures (Figure 1A). Then, BamH I/Xho I fragments were digested from pmiR242 + 276 and cloned into pcDNA™6.2-GW/EmGFP-miR using a BLOCK-iT™ Pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen), to generate the recombinant plasmid pEGFP-miR242 + 276 expressing EGFP (Figure 1A). The pcDNA6.2-GW/miR-negative control plasmid (pmiR-NC) was provided by Invitrogen (Table 1) and has no sequence homology with FMDV. All of these plasmids were confirmed by DNA sequencing.

The plasmids expressing MEST, PURA and the vector control, as well as the shRNAs against MEST (shMEST), PURA (shPURA) and the scrambled negative control (shCON), were obtained from TranSheepBio (Shanghai, China). To generate MEST overexpression stable cell lines, plasmid containing the MEST cDNA was co-transfected with the 3rd generation packaging plasmids (Addgene_12251, Addgene_12253, Addgene_12259) into HEK293T cells (CVCL_0063) using Lipofectamine 3000 as previously described.^{5 ,15} (link) Supernatants were collected 48 h after transfection, centrifuged at 1500 rpm for 5 min, and filtered through a 0.45 μm filter. ESCC cells were infected to produce stable cell lines. After 7 days of puromycin selection (1 μg/ml), the MEST protein level was analyzed by Western blot. The BLOCK-iT™ Pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen, #K493600) was used to construct the vectors expressing miR-449a and the scrambled miRNA control (miR-CON). The miR-449a mimic (#4464066) and negative control (#4464058) were ordered from Thermo Fisher Scientific. The miRIDIAN anti-miR-449a inhibitor (IH-300723-05) and the corresponding negative control (IN-001005-01) were purchased from GE Healthcare Dharmacon (Lafayette, CO, USA).

MicroRNA-Twist1 was generated using the Block-iT™ PolII miR RNAi expression vector kit with EmGFP (Invitrogen Life Technologies) according to the manufacturer’s instructions. Four pairs of oligo sequences targeted to Twist1 silencing were tested and a scrambled microRNA was used as a control. The sequences targeting the Twist1 gene-coding region were annealed and inserted into the pcDNA6.2-GW/EmGFPmiR vector to generate the microRNA interfering expression vector. We selected one pair of the sequence in which Twist1 was silenced most effectively and constructed the stable transfectant with this sequence. Briefly, the most effective sequence of microRNA-Twist1 and scrambled control was as follows: Twist1-oligo-F, 5′-TGCTGCTGCCGGTCTGGCTCTTCCTCGTTTTGGCCACTGACTGACGAGGAAGACAGACCGG CAG-3′, Twist1-oligo-R, 5′-CCTGCTGCCGTCTGTCTTCCTCGTCAGTC AGTGGCCAAAACGAGGAAGAGCCAGACCGGCAGC-3′; control-F: 5′-tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT-3′, control-R: 5′-cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc-3′.

Vectors carrying miRNAs were constructed using the BLOCK-iT pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen, Carlsbad, CA, USA). The primary miR-29b-1-5p and miR-29b-2-5p sequences with flanking regions were amplified by PCR and then coloned into pcDNA6.2-GW/EmGFP-miR. Lentivirus for miR-29b-1-5p and miR-29b-2-5p was produced using 293T cells by co-transfection with lipofectamine-2000 (Invitrogen, Carlsbad, CA, USA) according to the protocol according to the instruction. MiR-29b-1-5p and miR-29b-2-5p expression were examined using real time RT-PCR.

The generation of the lentivirus and adenovirus was performed as previously reported^{40 (link)}. Knockdown experiments for Pten were performed based on the lentivirus-mediated expression of the microRNA (miRNA) system using the BLOCK-iT Pol II miR RNAi Expression Vector Kit with EmGFP (Invitrogen). The sequences of DNA oligos for this purpose were designed using BLOCK-iT RNAi Designer provided by the manufacturer and hybridized oligos were inserted in the pcDNA6.2-GW/EmGFP-miR vector, followed by transfer into the pDONR vector by the BP reaction system (Invitrogen). To generate the lentivirus, the insert was recombined into the CSII-EF-RfA–IRES-puro vector (a kind gift from Dr. Hiroyuki Miyoshi (RIKEN BRC, Ibaraki, Japan) with the LR recombination reaction system (Invitrogen). The lentivirus was generated according to the manual provided by RIKEN BRC. UMR106 cells were infected with the lentivirus in the presence of 5 μg/mL polybrene (Sigma) and selected by puromycin (1 μg/mL). In the case of the generation of the adenovirus, the insert was recombined into the pAd-CMV-V5 vector (Invitrogen) using the LR recombination reaction system (Invitrogen). The adenovirus was generated using the ViraPower Adenovirus Expression System (Invitrogen) according to the manufacturer’s protocol.