Nanodrop analyzer

We performed a qPCR assay to validate the gene expression changes obtained from the transcriptomic analysis. The primer sequences were shown in Table 1. Total RNA of the injured spinal cord was extracted with TRIzol reagent. Thermo Nanodrop Analyzer and Light Cycle 96 Real-time PCR system were used to assess the quality of RNA and to perform reverse transcription, respectively. Relative expression of genes was determined using the 2^–ΔΔCt method using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference. The gene expression was tested in three rats and each sample was tested in triplicate.

After treatment as described above, cells were lysed and RNA was collected using the RN-easy plus kit (QIAGEN). Concentration and quality were determined using a nanodrop analyzer (thermo). One hundred nanograms of RNA was mixed with vilo superscript cDNA reverse transcription mix (Thermo) to create a cDNA template. RT-PCR was performed using the power up SYBR Green mastermix (Applied Biosystems) on a step-one plus real-time PCR machine (Applied Biosystems). The following “fast” cycling conditions were used: 2 min 50° C, 1 min 95 °C, 15 s 95 °C, and 3 s 60 °C with read. This was repeated for 40 cycles followed by a melt curve. The primers used were TNFα, IL1β, IL6, MARCO, ARG1, IGF1, ACTB, and YM1 (IDT Primetime Primers, ref seq NM_013693, NM_008361, NM_031168, NM_010766, NM_007482, NM_1055770, NM_009892) at a concentration of 500 nM.

HepG2 and L02 cells (5 × 10⁴) were seeded and cultured in six-well plates. The success of transduction was assessed by fluorescence microscope. Thereafter, mRNA expressions of human CYP3A4 in the CYP3A4 OE HepG2 and L02 cells were determined by Q-PCR. Total RNA was extracted with TRIzol reagent (Vazyme Biotech Co., Ltd., Nanjing, China). The RNA quality was assessed with a Thermo Nanodrop Analyzer and only RNAs with OD₂₆₀/OD₂₈₀ ranging from 1.8 to 2.0 were used for further experiments. The primers (Table 1) were from Genscript Biotech Co., Ltd. (Nanjing, China), and reserve transcription was performed with a kit (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacture’s instruction. The reverse reactions with a system containing 1000 ng of RNA were performed at 25°C for 10 min, 50°C for 30 min and 85°C for 5 min. PCR was performed on a Light Cycle 96 Real-time PCR system (Roche, Basel, Switzerland). In addition, 20 mg of each mouse liver sample was weighed, and homogenized with 1 mL TRIzol at 60 Hz for 30 s in 4°C. The supernatant was separated to extract the RNA. Other procedures were the same as described except that mouse primers were used (Supplementary Table S1). Human and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as control.

RNA was extracted from plasma samples using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol. The quantity and quality of RNA was determined by 260:280 ratio using NanoDrop Analyzer (Thermo Scientific, Waltham, MA, USA). Following RNA extraction, miRCURY LNA RT Kit (Qiagen, Hilden, Germany) was used for our RT reactions, to synthesize cDNA, with 50 ng of total RNA for each reaction, as described previously [109 (link),110 (link)]. To normalize the miRNA expression, an internal control, a synthetic spike-in, was used. Next, miRNA specific primers were used, combined with SYBR Green Master Mix at a final volume of 10 μL, to perform RT-PCR reactions in a 96-well plate. Three technical replicates were used per sample to ensure accuracy in the RT-PCR amplification data which was run on a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA, USA). The comparative threshold cycle (Ct) method was used to calculate the fold amplification as specified by the manufacturer. The following is the sequence of human miRNA primers used for our RT-PCR reactions: hsa-miR-122–3p: 5’AACGCCAUUAUCACACUAAAUA; hsa-miR-34a-3p: 5’CAAUCAGCAAGUAUACUGCCCU; has-miR-375–3p: 5’UUUGUUCGUUCGGCUCGCGUGA; hsa-miR-16–5p: 5’UAGCAGCACGUAAAUAUUGGCG; has-miR-21–3p: 5’CAACACCAGUCGAUGGGCUGU

Sludge samples were analyzed for DNA before and after incubation. Three independent DNA extractions of each treatment were performed from 30 mg of sludge using a FastDNA SPIN Kit for Soil (MP Biomedical, LLC, Ohio, USA). The extraction was performed according to the manufacturer's instructions. The concentrations and the quality of DNA samples were measured with a Nanodrop analyzer (Thermo Scientific, Wilmington, DE, USA). Extracted DNA was stored at −20°C prior to subsequent analyses.

RNA Extraction was done using miRNeasy Serum Plasma Kit (Qiagen, Hilden, Germany). We followed manufacturer’s protocol to extract RNA from our serum samples and further analyzed the quantity and quality of our RNA by 260:280 ratio using NanoDrop Analyzer (Thermo Scientific). Following the RNA extraction, we used miRCURY LNA Universal RT microRNA PCR Kit (Exiqon, Vedbaek, Denmark) for our RT reactions, to prepare cDNA, with 50ng of total RNA for each reaction. Further, miRNA specific primers were used, combined with SYBR green master mix, to perform RT-PCR reaction. Three technical replicates were used for each sample allowing more accuracy in the final qRT-PCR amplification data which was run on a 7500 Fast Real Time PCR System (Applied Biosystems). This protocol has been detailed previously [21 (link)]. Following is the sequence of miRNAs:
hsa-miR-24-3p (UGGCUCAGUUCAGCAGGAACAG);
hsa-miR-34a-5p (UGGCAGUGUCUUAGCUGGUUGU);
hsa-miR-29a-3p (UAGCACCAUCUGAAAUCGGUUA);
hsa-miR-208b-3p (AUAAGACGAACAAAAGGUUUGU);
hsa-miR-126 (UCGUACCGUGAGUAAUAAUGCG).