Total RNA was prepared from whole cells by using Trizol (Ambion) as described previously (31 (link)). Briefly, for northern blot analyses, 2-3 μg of RNA was mixed with 10 μl of RNA sample loading buffer (Sigma), and separated on a denaturing 1.2% agarose gel containing 5.49 M formaldehyde. The quality of the RNA was assessed under UV using the BioRad ChemiDoc MP Imaging System prior to transferring the RNA onto a nylon membrane (Nytran®, SuPerCharge, GE Healthcare Life Science Whatman). The RNA bound to the nylon membrane was cross-linked with UV light at 254 nm and pre-hybridized in ultrahybridization ultrasensitive hybridization buffer (Invitrogen) at 42°C for 1 h. Subsequently, 100 ng of the specific DNA probes were added to the membrane and allowed to hybridize overnight at 42°C. The probes were created by PCR on genomic DNA, column-purified (Promega) and labeled with [α-32P] dATP by random priming. For qRT-PCR analysis of the steady-state levels of mitochondrial RNAs, total RNA was extracted from whole cells by using Trizol, followed by DNAse digestion (Invitrogen) and reverse-transcribed to cDNA (Applied Biosystems) and analyzed with specific primer pairs for each gene following standard procedures. Primers used in this study are listed in the Supplementary Table S7 .
Rna sample loading buffer
Manufactured by Merck Group
Sourced in United States
RNA sample loading buffer is a solution used in molecular biology to prepare RNA samples for electrophoresis. It facilitates the loading and visualization of RNA samples on an agarose gel.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Dnase digestion, by Thermo Fisher Scientific (1 mentions)
Chemidoc mp imaging system, by Bio-Rad (1 mentions)
Rapid hyb buffer, by Cytiva (1 mentions)
Random priming kit, by Agilent Technologies (1 mentions)
Totally rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Turbo dna free, by Thermo Fisher Scientific (1 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Northernmax mops gel running buffer, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
1 kb ladder, by Thermo Fisher Scientific (1 mentions)
Hematoxylin and eosin, by Merck Group (1 mentions)
Rna labeling kit, by Roche (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
T7 rna polymerase, by Thermo Fisher Scientific (1 mentions)
Phenol chloroform isoamyl alcohol 25 24 1, by Merck Group (1 mentions)
M13mp18 dna, by New England Biolabs (1 mentions)
Biotin 16 utp, by Merck Group (1 mentions)
7 protocols using rna sample loading buffer
1
Northern Blot and qRT-PCR for Mitochondrial RNA Analysis
2
Northern Blot Analysis of Mitochondrial Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from heart tissue either by using the ToTALLY RNA isolation kit (Ambion) or by using TRIzol Reagent (Invitrogen), and subjected to DNase treatment (TURBO DNA-free, Ambion). 1–2 μg of total RNA was denatured in RNA Sample Loading buffer (Sigma), electrophoresed in 1 or 1.8% formaldehyde-MOPS agarose gels prior transfer onto Hybond-N+ membranes (GE Healthcare). After UV crosslinking the membranes were successively hybridized with various probes at 65°C in RapidHyb buffer (Amersham) and then washed in 2x SSC/0.1% SDS and 0.2x SSC/0.1% SDS before exposure. Mitochondrial probes used for visualization of mRNA and rRNA levels were restriction fragments labeled with α-32P-dCTP and a random priming kit (Agilent). Different tRNAs and 7S rRNA were detected using specific oligonucleotides labeled with γ-32P-dATP. Radioactive signals were detected by autoradiography.
3
Maize COP1 Expression during Ear Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
Northern Blot Analysis of the Expression of Maize COP′ During Ear Development was performed. Total RNA (15 μg each) from different tissues were mixed with one volume of RNA Sample Loading Buffer (Sigma, R-4268), heated at 65° C. for 10 min., chilled on ice for one min. and loaded on a 1% formaldehyde agarose gel. The RNA was separated on the gel under constant voltage at 65 v for 4 to 5 hours and then transferred onto a piece of nylon membrane at 4° C. overnight using a Schleicher & Schuell transfer system (Keene, N.H., USA 03431). A 157 base pair 3′UTR fragment of COP1 was amplified by PCR using forward primer 3′COP1 (5′TGCTCCTTGATGTTATGG3′; SEQ ID NO: 7) and reverse primer L30623′COP1R. A 910 base pair5′ fragment was also amplified by PCR using forward primer COP15-6 and COP301 (5′GATGAATTCATCAAGGAGGATCAGAAGAAG3′; SEQ ID NO:8). Purified PCR products (25 ng each) were labeled with p32dCTP using Random Primed DNA Labeling Kit (Boehringer Mannheim, Cat. #1004760). The membrane was hybridized with both labeled 3′UTR and 5′COP1 probes.
4
Mitochondrial RNA Labeling and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
400 μg isolated mitochondria were resuspended in incubation buffer (1 mg/ml BSA, 20 μCi [α-33P] UTP (3000 Ci/mmol)). Subsequently, the samples were incubated for 1 h at 37°C on a rotating wheel. Mitochondria were re-isolated by centrifugation for 2 min at 9000 g, resuspended in 500 μL incubation buffer supplemented with 2 mM UTP and incubated for 10 min at 37°C. Samples were centrifuged at 9000 g for 4 min at 4°C and mitochondria washed twice with incubation buffer. Mitochondrial RNA was purified by the RNeasy Mini Kit (QIAGEN). Samples were mixed in a 1:2 ratio with RNA sample loading buffer (Sigma), incubated at 65°C for 15 min, followed by 2 min incubation on ice. Samples were analyzed using Formaldehyde-agarose gels (1.2% agarose (RNase free, Ambion), 2.2 M formaldehyde in NorthernMax MOPS gel running buffer (Ambion)). Gels were vacuum dried and analyzed by autoradiography. For staining of mitochondrial rRNAs, a wet transfer was performed in 20x SSC overnight onto a nylon membrane followed by staining with Methylene Blue (Molecular Research Center Inc.) for 10 min.
5
Synapsin Riboprobe Synthesis and In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A digoxigenin-labeled antisense riboprobe for synapsin was synthesized from cDNAs cloned in the pGEM®-T Easy Vector (Promega) following the manufacturer’s protocol (RNA labeling kit, Roche Applied Science, Monza, Italy). The length and quality of the DIG-labeled RNA synapsin probe was controlled on an agarose gel. According to manufacturers, 1 μg of probe was added to 3 volumes of RNA sample loading buffer (Sigma-Aldrich) heated to 65 °C for 10 minutes, and then chilled on ice. The probe was loaded onto a TAE/1% agarose/sybrSafe gel next to 1 kb ladder (ThermoFisher Scientific) and run at 80 V.
One band at the expected length of ≈810 nt is clearly visible (see Additional File5a ). The probe was a fragment of ~810 nucleotides complementary to the common part of long and short synapsin isoforms. In situ hybridization (ISH) was carried out on O. vulgaris SEM (see Additional File 5b ), ovary and testis 20 μm-frozen sections as described by14 (link),52 (link), hybridized overnight at 60 °C. Sections were post-fixed in 4% paraformaldehyde (PFA) and mounted with Mowiol. Parallel sections were stained with hematoxylin and eosin (Sigma-Aldrich).
One band at the expected length of ≈810 nt is clearly visible (see Additional File
6
RNA Denaturation and Marker Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthetic ssRNA and dsRNA was diluted to 100 pg with 5 μg of wild-type maize B104 leaf total RNA. An aliquot of both was treated with RNase If to remove the ssRNA and another aliquot was left un-treated. The samples were then precipitated and resuspended in 20 μL of RNA sample loading buffer (Sigma-Aldrich, St. Louis, MO, USA). Five microliter (5 ng) of 0.3-1.5Kb DIG-labeled RNA molecular weight marker III (Roche) was aliquoted and added to 15 μL of RNA sample loading buffer. Samples and marker were denatured at 70 ͦ C for 15 min and immediately placed on ice.
7
In Vitro Transcription Assay on ssDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The in vitro transcription assay on ssDNA template was carried out as described previously (Wanrooij et al., 2008) . The 20 l reaction mix containing 80 ng of single-stranded M13mp18 DNA (New England Biolabs), 10 mM Tris HCl (pH 8.0), 100 g/ml BSA, 20 mM MgCl2, 1 mM DTT, 1 mM each ATP, CTP and GTP, 0.65 mM UTP, 0.35 mM Biotin-16-UTP (Sigma), 10 units of RNase inhibitor (Thermo Fisher Scientific), with the indicated amount of T7 RNA polymerase (Ambion) or 500 fmol of purified recombinant proteins was incubated at 32 °C for 30 min. The RNA products were extracted twice with Phenol:
Chloroform: Isoamyl Alcohol 25:24:1 (Sigma) and precipitated with 2.5 -3.0 volumes of ethanol for 1 h to overnight at -20 °C. The samples were dissolved in RNA sample loading buffer (Sigma), denatured for 5 min at 75 °C, and analyzed on a denaturing polyacrylamide gel. The products were detected by the Chemiluminescent Nucleic Acid Detection Module (Thermo Fisher Scientific). To semi-quantify the level of in vitro transcription, the total densitometry of Biotin-16-UTP chemiluminescence in each lane was measured and normali ed to that of 0.1 pmol 5 -Biotin-ssRNA, which was loaded on the same gel and hence used as the internal standard. The relative level of Biotin-16-UTP in each reaction was calculated and plotted.
Chloroform: Isoamyl Alcohol 25:24:1 (Sigma) and precipitated with 2.5 -3.0 volumes of ethanol for 1 h to overnight at -20 °C. The samples were dissolved in RNA sample loading buffer (Sigma), denatured for 5 min at 75 °C, and analyzed on a denaturing polyacrylamide gel. The products were detected by the Chemiluminescent Nucleic Acid Detection Module (Thermo Fisher Scientific). To semi-quantify the level of in vitro transcription, the total densitometry of Biotin-16-UTP chemiluminescence in each lane was measured and normali ed to that of 0.1 pmol 5 -Biotin-ssRNA, which was loaded on the same gel and hence used as the internal standard. The relative level of Biotin-16-UTP in each reaction was calculated and plotted.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!