Realq plus 2x master mix green

Manufactured by Ampliqon

Sourced in Denmark, United States

The RealQ Plus 2x Master Mix Green is a ready-to-use solution for real-time PCR applications. It contains all the necessary components, including a DNA polymerase, buffer, dNTPs, and a green fluorescent dye for detection.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

58 protocols using realq plus 2x master mix green

Surface Marker Profiling of Mesenchymal Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

SMMSCs were confirmed by evaluating the expression of MSCs specific surface markers (including CD34, CD45, CD29, CD73) using RT-PCR analysis. ^{15 (link)}Cultured cells were harvested, and total RNA was isolated using an RNA extraction kit (Qiagen, USA) according to the manufacturer’s protocol.
At the end of the isolation process, the concentration of samples was determined with a spectrophotometer (Nanodrop; Thermo Fisher Scientific, Wilmington, DE, USA).
RevertAid™ First Strand cDNA Synthesis kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used for cDNA synthesis. Reverse transcriptionquantitative
polymerase chain reaction (RTqPCR) was performed using ABI Biosystems™ StepOne™ and RealQ Plus 2x Master Mix Green (Ampliqon A/S, Odense, Denmark).
The β2M housekeeping gene was used as the internal control of qPCR reactions. Reactions were amplified in a thermal cycler
(Applied Biosystems, Thermo Fisher Scientific Inc., USA) with thermal conditions set at 94 °C for 10 min followed by 40 cycles of 15 second
at 94 °C, 60 second at 58 °C, a final extension of 7 min at 72 °C, and melt curve analysis of 55~95 °C at 0.5 °C per five second.
The analysis of real-time PCR data was performed using the 2^-ΔΔCt method ^{16 (link)}with target mRNA expression in each sample normalized against the endogenous control.

Estakhri F., Reza Panjehshahin M., Tanideh N., Gheisari R., Azarpira N, & Gholijani N. (2021). Efficacy of Combination Therapy with Apigenin and Synovial Membrane-Derived Mesenchymal Stem Cells on Knee Joint Osteoarthritis in a Rat Model. Iranian Journal of Medical Sciences, 46(5), 383-394.

+ Open protocol

+ Expand

RT-qPCR Validation of Regulator Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse-transcription quantitative PCR (RT-qPCR) was performed to validate response regulator overexpression in overexpression mutants (CEP::rr01, CEP::rr03, CEP::rr04, CEP::rr05, CEP::rr06, CEP::rr08, CEP::rr09, CEP::rr10, CEP::rr11, CEP::rr13, CEP::rr14) compared to wild-type grown in C + Y medium at 37°C to an OD₆₀₀ 0.4, in biological triplicates. RNA was extracted as previously described. 1 μg RNA from each strain was treated with RNase-free DNase I (New England BioLabs) before cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, Thermo Fisher). Real time quantitative PCR was carried out with RealQ Plus 2x Master Mix Green (Ampliqon) using gene-specific primers on a LightCycler 480 System. Primers used are listed in Supplementary Table S1 (primers #29–55) and were designed to produce amplicons of 150–200 bp.

Pettersen J.S., Nielsen F.D., Andreassen P.R., Møller-Jensen J, & Jørgensen M.G. (2024). A comprehensive analysis of pneumococcal two-component system regulatory networks. NAR Genomics and Bioinformatics, 6(2), lqae039.

+ Open protocol

+ Expand

Quantitative Analysis of Cytokine Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated RNA was utilized to make cDNA using Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany, 04897030001). Real Q Plus 2x Master Mix Green (Ampliqon, 5000830) and Step One Plus Applied Biosystems Real Time PCR instrument (Foster City, CA, USA) were used for quantitative PCR. Primers are explained in Table 1. β2M, a housekeeping gene, was used for normalization. Triplicate experiments were performed for each sample and the average Ct value was determined. Comparative Ct method was used for the analysis of IL-1β, IL-2, and TNF-α gene expressions (16 (link)). Relative mRNA expression for each sample was computed using the following equation: relative mRNA expression = (2(Ct β2M-Ct of cytokines)) × 1000. PCR Primers are shown in Table 1.

Aryaeian N., Mahmoudi M., Shahram F., Poursani S., Jamshidi F, & Tavakoli H. (2019). The effect of ginger supplementation on IL2, TNFα, and IL1β cytokines gene expression levels in patients with active rheumatoid arthritis: A randomized controlled trial. Medical Journal of the Islamic Republic of Iran, 33, 154.

+ Open protocol

+ Expand

Quantitative Analysis of Proinflammatory Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

The colon samples were extracted with RNeasy^® Plus Mini kit (QIAGEN, Venlo, Netherlands). RNA yield and quality were checked by NanoDrop Spectrophotometer (Thermo Scientific, Waltham, MA, United States). Reverse transcription was performed with SuperScript^TM II Reverse Transcriptase (Invitrogen, Waltham, MA, United States). The expression level of proinflammatory cytokines and chemokines were measured by quantitative reverse transcription-polymerase chain reaction using RealQ Plus 2X Master Mix Green (Ampliqon, Denmark) with β-actin as the reference gene in each reaction (Table 1). The data were analyzed by using the ΔΔCt method and expressed as the fold change in transcript level under the test condition compared to the average for the indicated control and then normalized to the reference gene β-actin. Statistical analyses were done by using GraphPad Prism 6.0.

Liu Y.W., Chen Y.H., Chen J.W., Tsai P.J, & Huang I.H. (2017). Immunization with Recombinant TcdB-Encapsulated Nanocomplex Induces Protection against Clostridium difficile Challenge in a Mouse Model. Frontiers in Microbiology, 8, 1411.

+ Open protocol

+ Expand

Nicotine Modulation of Cardiac Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

As the expression of cardiac genes in the case and control groups was intended to be quantified in 2 days (days 3 and 7), MSCs were cultured in two pairs of T25 culture flasks. MSCs were first exposed to 5-azacytidine for 24 h. After this period of cardiogenic induction, cells were treated with either 100 nM nicotine or the same volume of PBS as the case and control groups. On days 3 and 7, the appearance of cells in both the case and control groups was monitored by inverted microscopy. On the corresponding days, the culture medium was removed, and cells were washed with PBS and treated with trypsin/EDTA. Following centrifugation of the suspension, the cell pellet was yielded and subjected to RNA extraction (Rnx Plus Solution, CinnaGen Co). The quality and quantity of RNA were examined by NanoDrop. Using the reverse transcriptase enzyme, cDNA was synthesized (AddScript cDNA Synthesis Kit, addbio), and then qPCR (RealQ Plus 2x Master Mix Green, Ampliqon) was performed using cardiac-specific primers of GATA4 and troponin (Table 1). This experiment was repeated two times. Differential gene expression was revealed between the case and control groups on days 3 and 7. All the experiments were performed three times.

Gheisari M., Nosrati S., Zare S., Dara M., Zolghadri S, & Razeghian-Jahromi I. (2024). The impact of high nicotine concentrations on the viability and cardiac differentiation of mesenchymal stromal cells: a barrier to regenerative therapy for smokers. Frontiers in Cell and Developmental Biology, 12, 1323691.

+ Open protocol

+ Expand

Profiling COVID-19 lncRNA Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted from the whole blood samples by Hybrid-R™ blood RNA extraction kit (GeneAll Biotechnology, South Korea) following the manufacturer's instructions. cDNA was synthesized using the Thermo Scientific RevertAid Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA). qPCR was performed to quantify the expression profile of lncRNAs ANRIL, MALAT1, THRIL, and NEAT1 in whole blood of COVID-19 patients and healthy control group using the SYBR Green (RealQ plus 2x Master Mix Green, Ampliqon, Odense, Denmark) approach with relevant forward and reverse primers, the β2-Microglobulin was served as the internal reference gene. The qPCR was performed as follows steps: 95 °C for 15 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 60 s. The relative expression of RNA was computed based on the 2^−ΔΔCT method. The primer sequence was as follows:
5′-TTATGCTTTGCAGCACACTGG-3′ (forward) and 5′-GTTCTGCCACAGCTTTGATCT-3′ (reverse) for ANRIL, 5′-CTTCCTCCCTTTAACTTATCCATTCAC-3′ (forward) and 5′-CTCT TCCTCCACCATTACCAACAATAC-3′ (reverse) for NEAT1, 5′-AAAGCAAGGTCTCCCCA CAA-3′ (forward) and 5′-GGTCTGTGCTAGATCAAAAGGCA-3′ (reverse) for MALAT1, 5′-CTGGGACTACAGATGCACCAC-3′ (forward) and 5′-GGAGGGAGCATGTCTGTTTCT-3′ (reverse) for THRIL, and 5′-TGCTGTCTCCATGTTTGATGTATCT-3′ (forward) and 5′-TCTC TGCTCCCCACCTCTAAGT-3′ (reverse) for β2-Microglobulin.

Rahni Z., Hosseini S.M., Shahrokh S., Saeedi Niasar M., Shoraka S., Mirjalali H., Nazemalhosseini-Mojarad E., Rostami-Nejad M., Malekpour H., Zali M.R, & Mohebbi S.R. (2023). Long non-coding RNAs ANRIL, THRIL, and NEAT1 as potential circulating biomarkers of SARS-CoV-2 infection and disease severity. Virus Research, 336, 199214.

+ Open protocol

+ Expand

Liver Gene Expression Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assay transcriptional expression of iNOS, CD206, SOD2 (the main enzyme for clearing mitochondrial reactive oxygen species [ROS]) [42 (link)], and GLUT1 (the main transporter for glucose uptake) [43 (link)], we performed total liver RNA extraction (REzol C&T RNA Extraction Reagent; Protech Technology, Taipei, Taiwan), reverse transcription (HiScript I First Strand cDNA Synthesis Kit; Bionovas Biotechnology, Toronto, ON, Canada), and real-time polymerase chain reaction (PCR) amplification (RealQ Plus 2X Master Mix Green; Ampliqon A/S, Odense, Denmark). Primers for amplifications were iNOS forward: CAGCTGGGCTGTACAAACCTT and reverse: CATTGGAAGTGAAGCGTTTCG [44 (link)]; CD206 forward: CAGGTGTGGGCTCAGGTAGT and reverse: TGTGGTGAGCTGAAAGGTGA [42 (link)]; SOD2 forward: CAGACCTGCCTTACGACTATGG and reverse: CTCGGTGGCGTTGAGATTGTT [44 (link)]; and GLUT1 forward: GAACCTGTTGGCCTTTGTGGC and reverse: GCTGGCGGTAGGCGGGTGAGCG [43 (link)]. The mRNAs of the target genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; internal standard) [43 (link)].

Chang C.Y., Chen K.Y., Shih H.J., Chiang M., Huang I.T., Huang Y.H, & Huang C.J. (2021). Let-7i-5p Mediates the Therapeutic Effects of Exosomes from Human Placenta Choriodecidual Membrane-Derived Mesenchymal Stem Cells on Mitigating Endotoxin-Induced Mortality and Liver Injury in High-Fat Diet-Induced Obese Mice. Pharmaceuticals, 15(1), 36.

+ Open protocol

+ Expand

Quantitative RT-PCR Validation of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The genes identified based on the primary high-throughput sequencing data were evaluated in additional 100 participants (25 per group) using qRT-PCR. Total RNA was isolated from all samples as described before. Contaminating genomic DNA was removed with a DNase I treatment (Qiagen, Germany). RNA was reverse transcribed to cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Germany) according to the manufacturer's protocols. The qRT-PCR was carried out on the RotorGene 6000 device (Corbett, Mortlake, New South Wales, Australia), and qRT-PCR reactions were performed with RealQ Plus 2x Master Mix Green (Ampliqon, Denmark) using specific gene primers (Metabion, Germany). Primer pairs used in this study are listed in Table 1. PCR program was as follows: predenaturation at 95°C for 10 min, followed by 40 cycles of PCR followed by 40 cycles of 95°C for 15 s, 57°C for 30 s, and 68°C for 30 s. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) was used as a housekeeping gene for standardizing targeted mRNA expression. mRNA expression patterns were analyzed according to the 2^−ΔΔCT method [20 (link)]. The relative values of the gene of interest were represented as fold change (FC) to compare mRNA levels between patients.

Poortahmasebi V., Nejati A., Abazari M.F., Nasiri Toosi M., Ghaziasadi A., Mohammadzadeh N., Tavakoli A., Khamseh A., Momenifar N., Gholizadeh O., Norouzi M, & Jazayeri S.M. (2022). Identifying Potential New Gene Expression-Based Biomarkers in the Peripheral Blood Mononuclear Cells of Hepatitis B-Related Hepatocellular Carcinoma. Canadian Journal of Gastroenterology & Hepatology, 2022, 9541600.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Rat Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primers for qPCR analysis for rat MGMT, E2F6, RELA, and Actb (as internal control) genes were designed by Primer3 web-based server [36 ] and Integrated DNA Technologies (IDT) (Coralville, IA, USA). Their specificity was tested with Primer-BLAST of the NCBI genome browser. The used primer sequences are listed in Table 1. The mRNAs expression levels were carried out on a Rotor-Gene 3000 system (Corbett Research, Sydney, Australia), using the synthetic primers and Real Q Plus 2x Master Mix Green (Ampliqon, Denmark #A323402), according to the protocol provided by the manufacturer. Eventually, a 2^−ΔΔct method was used for gene expression analysis.

Mazarei M., Mohammadi Arvejeh P., Mozafari M.R., Khosravian P, & Ghasemi S. (2021). Anticancer Potential of Temozolomide-Loaded Eudragit-Chitosan Coated Selenium Nanoparticles: In Vitro Evaluation of Cytotoxicity, Apoptosis and Gene Regulation. Nanomaterials, 11(7), 1704.

+ Open protocol

+ Expand

Urine Exosome lncRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

PrimeScript^™ RT reagent Kit (Takara, Tokyo, Japan) was used for cDNA synthesis. Expression levels of lncRNA genes in urine exosomes were measured in the rotor gene 6,000 corbett Real-Time PCR System using RealQ Plus 2x Master Mix Green (Ampliqon, Herlev, Denmark). 5S rRNA was used as normalizer. All experiments were per formed in duplicate in 30 µL total volumes. The nucleotide sequence of primers used in expression analyses are shown in Table 1.

Yazarlou F., Modarressi M.H., Mowla S.J., Oskooei V.K., Motevaseli E., Tooli L.F., Nekoohesh L., Eghbali M., Ghafouri-Fard S, & Afsharpad M. (2018). Urinary exosomal expression of long non-coding RNAs as diagnostic marker in bladder cancer. Cancer Management and Research, 10, 6357-6365.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!