Hiscript q rt supermix for qpcr

The cotton (86 III 72 glanded and 86 III 72 glandless) ovules of 30 DPA and young leaves were collected, and total RNA were extracted using an RNAprep Pure Kit (Tiangen Biochemical Technology (Beijing, China) Co., Ltd.). Each sample included three individual biological replicates. cDNA was synthesized using HiScript^®Q RT SuperMix for qPCR (Vazyme, China) according to the protocol for qRT-PCR analysis. The qRT-PCR primers of genes were designed through Primer Premier 5.0 (Table S11). The qRT-PCR was carried out in a 20 uL volume, with three replicates for each sample including 10 μL 2 × SuperReal Color PreMix, each of the forward and reverse primers 0.6 μL (10 μM), 1 μL cDNA (50 ng μL^–1), 0.4 μL 50 × ROX reference dye, and 7.4 μL RNase-free ddH₂O. The qRT-PCR reaction conditions were 95 °C for 15 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s in the PCR stage. Data acquisition and analyses were performed using the QuantStudio^TM Real-Time PCR Software (Thermo Fisher Scientific, Waltham, MA, USA). The data were normalized by the internal control gene UBQ7 (DQ116441) and the relative expression level was calculated using the 2^–ΔΔCT analysis method [36 (link)].

We selected two genes (bAS and CHS) for quantitative real-time PCR (qRT-PCR) analysis, whose counterpart proteins are key enzymes in the biosynthesis of glycyrrhizin and flavonoid. The qRT-PCR reactions were carried out with a Trizol Total RNA Isolation Kit (Sangon Biotech, Shanghai, China) according to the protocols. cDNA pools for qRT-PCR from the total RNA were synthesized using HiScript Q RT SuperMix for qPCR (Vazyme Biotech Co.,Ltd, Nanjing, China). The primers were designed using Primer 3.0 softwaree (http://bioinfo.ut.ee/primer3-0.4.0/). The reference gene used β-actin. The relative expression level of genes was calculated using a real-time PCR system (ABI 7500 Real-Time PCR System) based on the 2^-ΔΔCt method. Primers for RT-qPCR are listed in Table S2.

Islets (100 islet per group) and Min6 cells were isolated using TRIZOL (Invitrogen), cDNA was generated using HiScript Q RT SuperMix for qPCR (Vazyme, China) and real-time PCR assays were conducted with a LC480 Light Cycler (Roche, Germany) using the applied primer sequences listed in Supplementary Table 9. Relative expression of genes was determined using a comparative method (2^-△CT). U6 and GAPDH were used as internal standards for miRNAs and mRNAs, respectively. For miR-802 and U6, TaqMan probes (Ambion) were used to confirm our results.

Proximal colon tissues (n = 5) were frozen in liquid nitrogen. RNA was extracted with RNA Isolater Total RNA Extraction Reagent (Vazyme Biotech Co., Ltd., China) and reverse-transcribed with HiScript™ Q RT SuperMix for qPCR (Vazyme Biotech Co., Ltd.), according to the manufacturers' instructions. With GAPDH as internal control, quantitative PCR was performed using AceQ™qPCR SYBR® Green Master Mix (Vazyme Biotech) on ABI StepOne™ Plus (Applied Biosystems, USA). Primers synthesized by Vazyme Biotech were as follows: c-kit, sense 5′-CCTCGCCTCCAAGAACTGTATT-3′ and antisense 5′-GCCGTGCATTTCCTTTTACC-3′; GAPDH, sense 5′-GAGTCCACTGGCGTCTTCA-3′ and antisense 5′-GGGGTGCTAAGCAGTTGGT-3′. PCR was performed for 40 cycles at 95°C (5 min), 95°C (10 s), and 60°C (30 s). Data were analyzed by the 2^−ΔCT method.

Based on the genetic sequences of porcine IFITM1, IFITM2, IFITM3, and Mx1 (GenBank: JQ315414.1, JQ315415.1, JQ315416.1, and DQ095779.1), specific primers were designed (Table 1). RT-qPCR was performed to define the relative mRNA expression of IFITMs and CSFV. Cells were treated with TRIzol to extract total RNA, which was reversed transcribed into cDNA using the HiScript Q RT Supermix for qPCR (Vazyme, Nanjing, China). RT-qPCR was performed using UltraSYBR Mixture (CWBIO, Beijing, China) according to the manufacturer’s instructions. Relative fold changes in gene expression were normalized against β-actin using the 2^−ΔΔCt threshold method.

Renal tissue or cultured GEnCs were collected for total RNA extraction using TRIzol reagent (Invitrogen, Carlsbad, CA). RNA purity and concentration were determined by measuring spectrophotometric absorbance at 260 and 280 nm (A260/280). Reverse transcription of mRNA was carried out using HiScript Q RT SuperMix for qPCR (Vazyme, Nanjing, China) as previously described.16 Expression level of mRNA was measured by a SYBR Green PCR assay using AceQTM qPCR SYBR Green Master Mix (Novland BioPharma, Shanghai, China). GAPDH mRNA was used as an internal control for RNA normalization. Primers were synthesized by GenePharma (Shanghai, China). Mouse primers: Chemerin: F 5'‐GGAGATCGGTGTGGACAGTG‐3', R 5'‐GGGTCCAGTTTGATGCAGG‐3'; ChemR23: F 5’‐ATGGAGTACGACGCTTACAACG‐3’, R 5’‐GGTGGCGATGACAATCACCA‐3’; TGF‐β1: F 5’‐AACAACGCCATCTATGAG‐3’, R 5’‐TATTCCGTCTCCTTGGTT‐3’; CD31: F 5’‐CACAGATAAGCCCACCAGAG‐3’, R 5’‐TGACAACCACCGCAATG‐3’; GAPDH: F 5’‐TGCATCCTGCACCACCAACTGC‐3’, R 5’‐ACAGCCTTGGCAGCACCAGTGG‐3’. Human primers: chemerin: F 5’‐GAAGAAACCCGAGTGCAAA‐3’, R 5’‐ACCAACCGGCCCAGAACT‐3’; ChemR23: F 5’‐TGGTCTACAGCATCGTC‐3’, R 5’‐ATGGCTGGGGTAGGAAGAGT‐3’; TGF‐β1: F 5’‐GGTGGAAACCCACAACGAAATC‐3’, R 5’‐AATTCCCCTCCACGGCTCAAC‐3’; GAPDH: F 5’‐CACCACCAACTGCTTAG‐3’, R 5’‐CTTCACCACCTTCTTGATG‐3’. Relative mRNA expression levels were calculated using ∆ ∆ Ct analysis.