Pcr clean up kit

Manufactured by Promega

Sourced in United States

The PCR clean-up kit is a laboratory tool designed to purify DNA samples after polymerase chain reaction (PCR) amplification. It removes unwanted components, such as primers, nucleotides, and enzymes, from the PCR product, allowing for the subsequent use of the purified DNA in downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Iscript cdna synthesis kit, by Bio-Rad (2 mentions) Rneasy column, by Qiagen (2 mentions) Lysing matrix d tube, by MP Biomedicals (2 mentions) Dnase treatment, by Thermo Fisher Scientific (2 mentions) Iq sybr green mix, by Bio-Rad (2 mentions) Synergy 2 with gen 5, by Agilent Technologies (2 mentions) Cfx96 qpcr cycler, by Bio-Rad (2 mentions) Fastprep 24, by MP Biomedicals (2 mentions) Wizard sv gel, by Promega (2 mentions) 1 kb ladder, by New England Biolabs (2 mentions) Protein g sepharose bead, by GE Healthcare (2 mentions) Mabe146, by Merck Group (2 mentions) Bioruptor, by Diagenode (2 mentions) Sab2702243, by Merck Group (2 mentions) Nbp2 42813, by Novus Biologicals (2 mentions) Gelred, by Biotium (1 mentions) Rnaprotect bacteria reagent, by Qiagen (1 mentions) Ribomax large scale rna production system, by Promega (1 mentions) Pgem t easy vector, by Promega (1 mentions) Pcr master mix, by Promega (1 mentions)

Close spelling variants of this product

Wizard® SV Gel and PCR Clean-Up System kit (76 citations) Wizard® SV Gel and PCR Clean-Up kit (72 citations) PCR clean-up system kit (15 citations) Wizard PCR clean-up kit (11 citations) Clean-up kit (6 citations) Wizard(R) SV Gel and PCR Clean-Up System kit (2 citations) Gel Extraction and PCR clean up kit (2 citations) Wizard Gel and PCR clean-up kit (2 citations) PCR clean-up system purification kit (2 citations)

33 protocols using pcr clean up kit

Telomeric Sequence Purification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purification of the telomeric sequences was performed following an adaptation of a previously described procedure [23 (link)]. A total of 1 µg genomic DNA of S. rimosus was digested overnight with the blunt-end restriction enzymes SmaI and PvuII. The products were then purified using the Promega PCR Clean-Up kit and eluted in a final volume of 90 µl with dH₂O. A total of 10 µl 1 M NaOH was added and the mixture was incubated for 1 h at 37 °C. The samples were neutralized using 2 M HCl and 1 M Tris (pH 8) was added to a final concentration of 0.1 M. A 20× SSC solution was then added to final concentration of 2× and the samples were incubated at 68 °C for 1 h. The samples were purified once again with the Promega PCR Clean-Up kit and ligated overnight using Promega T4 DNA ligase. Inverted PCR analyses were performed using the primers listed in Table S1, and the amplified products were purified and sequenced by Eurofins Genomics.

Algora-Gallardo L., Schniete J.K., Mark D.R., Hunter I.S, & Herron P.R. (2021). Bilateral symmetry of linear streptomycete chromosomes. Microbial Genomics, 7(11), 000692.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Liver Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liver samples from mice were flash frozen in liquid nitrogen and stored at −80°C prior to RNA extraction. Livers were homogenized in Lysing Matrix D tubes (MP Biomedicals) containing 700 μl RLT buffer with 1% (v/v) β-mercaptoethanol (QIAGEN) using a FastPrep-24 (MP Biomedicals) bead beater for 45 s at 6.5 m/s (repeated 3 times, incubating on ice for 1 minute in between rounds). Homogenates were centrifuged at 20,000 × g at 4°C for 5 minutes to pellet debris, RNA was extracted using phenol:chloroform:IAA, pH 6.7 (Sigma), and samples were mixed with 50% ethanol prior to being transferred to QIAGEN RNeasy columns, according to the manufacturer’s instructions. Cleaned RNA samples were subjected to DNase treatment (Invitrogen) prior to cDNA synthesis using an iScript cDNA synthesis kit (Bio-Rad). RNA was removed through the addition of 1 N NaOH at 65°C for 30 minutes, followed by the addition of an equal volume of 1 N HCl. cDNA was cleaned using a PCR clean-up kit (Promega) according to the manufacturer’s instructions. cDNA concentrations were adjusted to 1 ng/μl using the Synergy 2 with Gen 5 software (Bio-Tek) prior to qRT-PCR using iQ SYBR Green mix (Bio-Rad), gene-specific primers (Table S1), and a CFX96 qPCR cycler (Bio-Rad). Transcript abundance was calculated using the ΔΔCt method and data were normalized to β-actin gene expression.

Wexler A.G., Guiberson E.R., Beavers W.N., Shupe J.A., Washington M.K., Lacy D.B., Caprioli R.M., Spraggins J.M, & Skaar E.P. (2021). Clostridioides difficile infection induces a rapid influx of bile acids into the gut during colonization of the host. Cell reports, 36(10), 109683.

+ Open protocol

+ Expand

In Vitro Transcription and mRNA Stability

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sfGFP gene was PCR-amplified from the pY71 vector with T7-pro-F and T7-ter-R primers against the T7 promoter and the T7 terminator sequences (Table S1). The PCR-amplified linear template was then purified by using a PCR clean-up kit (Promega) and subsequently used as a template for in vitro transcription reactions according to the manufacturer's manual (Ribo-MAX Large Scale RNA Production System, Promega). The final concentration of mRNA was 1.8 mg mL⁻¹. In order to track mRNA stability in our extracts, we replaced the plasmid sfGFP with the mRNA of sfGFP (1800 ng) in the CFPS reaction. For direct measurement of mRNA degradation, 5 μL samples were taken from CFPS reactions during incubation at 30°C and mixed with equal volumes of RNAprotect Bacteria Reagent (Qiagen, Valencia, CA) and brought to 100 μL with RNase free water. All samples were then purified by using an RNeasy Mini total RNA purification kit (Qiagen) according to the manufacturer's manual. Purified mRNA was visualized on a 2% formaldehyde agarose gel stained with GelRed (Biotium, Hayward, CA, USA).

Hong S.H., Kwon Y.C., Martin R.W., Des Soye B.J., de Paz A.M., Swonger K.N., Ntai I., Kelleher N.L, & Jewett M.C. (2015). Improving Cell-Free Protein Synthesis through Genome Engineering of Escherichia coli Lacking Release Factor 1. Chembiochem : a European journal of chemical biology, 16(5), 844-853.

+ Open protocol

+ Expand

RT-PCR Amplification and Cloning of Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

The transcript-specific oligo's were used for the RT-PCR amplification using the cDNA templates of the control and HS-treated samples with 2x PCR master mix (Promega, Madison, UK). The PCR cycle followed was 98°C for 4 min, followed by 35 cycles of 94°C for 30 s, 58°C for 45 s, and 72°C for 1 min. Further, treatment of 72° for 10 min was given for the stabilization, followed by hold at 4°C. The amplified product was loaded on to 1% agarose gel and an amplicon of ~1.4 kb was observed; the product was eluted from the gel and cleaned with PCR clean-up kit (Promega, Madison, UK); the eluted product was cloned in pGEM-T Easy vector (Promega, Madison, UK) and transformed in E. coli strain DH5α competent cells, following the standard protocol (Sambrook et al., 1989 ). The cloned gene was subjected to restriction analysis, and sequenced using Sanger's di-deoxy method using T7 and SP6 primers.

Kumar R.R., Goswami S., Singh K., Dubey K., Singh S., Sharma R., Verma N., Kala Y.K., Rai G.K., Grover M., Mishra D.C., Singh B., Pathak H., Chinnusamy V., Rai A, & Praveen S. (2016). Identification of Putative RuBisCo Activase (TaRca1)—The Catalytic Chaperone Regulating Carbon Assimilatory Pathway in Wheat (Triticum aestivum) under the Heat Stress. Frontiers in Plant Science, 7, 986.

+ Open protocol

+ Expand

Purification and Storage of DNA Fragments

Check if the same lab product or an alternative is used in the 5 most similar protocols

The linear 5406 bps DNA fragments were amplified from pET28b by PCR. The DNA was separated on 0.7% agarose TAE gel, excised and extracted from the gel using a PCR cleanup kit (Promega). The DNA was further purified via ethanol precipitation, aliquoted at 0.1 pmol per tube and dried using the speedvac. It was stored at −20 °C. Prior to use, it was rehydrated in 10 microliter milliQ water and incubated at 37 °C for 1 hour at 300 rpm.

Varongchayakul N., Huttner D., Grinstaff M.W, & Meller A. (2018). Sensing Native Protein Solution Structures Using a Solid-state Nanopore: Unraveling the States of VEGF. Scientific Reports, 8, 1017.

+ Open protocol

+ Expand

Cloning and Expression of AeSSPs in Plants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The AeSSPs sequences were amplified by PCR from A. euteiches gDNA with specific primers (Additional file 6: ST3b). The CACC cloning site was added to each forward primer. PCR products were purified using the PCR Clean-Up Kit (Promega, Madison, WI, USA) and introduced in the pENTRY-D-TOPO vector (pENTR/D-TOPO Cloning Kit, Invitrogen). Positive clones were introduced in a pK7FWG2 vector (Invitrogen) or pAMpAT/YFP vector. After sequencing, positive clones were introduced in A. tumefaciens GV3101 and A. rhizogenes ARqua1. For the KDEL fusion, the GFP construct was amplified from the obtained pK7FWG2 vector by PCR using primers that introduced a C-terminal SEKDEL sequence (Additional file 6: ST3b). Cloning was performed as previously reported using a pK2GW7 vector (Invitrogen). For leaf infiltration, A. tumefaciens GV3101-transformed strains were syringe-infiltrated as described in [61 (link)]. For M. truncatula roots transformation, A. rhizogenes ARqua1 strains were used and confocal imaging was performed at 28 dpi, as described in [29 (link)].

Gaulin E., Pel M.J., Camborde L., San-Clemente H., Courbier S., Dupouy M.A., Lengellé J., Veyssiere M., Le Ru A., Grandjean F., Cordaux R., Moumen B., Gilbert C., Cano L.M., Aury J.M., Guy J., Wincker P., Bouchez O., Klopp C, & Dumas B. (2018). Genomics analysis of Aphanomyces spp. identifies a new class of oomycete effector associated with host adaptation. BMC Biology, 16, 43.

+ Open protocol

+ Expand

Generation and Cloning of MS2 Variant Libraries

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Single-stranded DNA primers were purchased that spanned the length of each 26-codon region of MS2 with appropriate cut sites for each corresponding entry vector (Supplementary Data 4). Primers for each entry vector were resuspended, pooled, and diluted to a final concentration of 50 ng/µL. The reverse strand was filled in using a touchdown PCR^{62 (link)} with 10-mers directed to the golden gate cut sites. The amplified, double-stranded DNA was purified using a PCR Clean-up Kit (Promega, Cat# A9282), then diluted to 1–5 ng/µL. These mixtures were cloned into their respective entry vectors using EMPIRIC cloning^{48 (link)}, which relies on established golden gate cloning techniques^{60 (link)}. The ligated plasmids were transformed into chemically competent DH10B E. coli and plated on large (245 × 245 × 20 mm, #7200134, Fisher) LB-A plates with 32 µg/mL chloramphenicol. Colony number varied, but every transformation yielded a number of colonies that was at least three times the theoretical library size. This protocol was repeated in full for three total biological replicates that are fully independent from library generation through selection.

Hartman E.C., Jakobson C.M., Favor A.H., Lobba M.J., Álvarez-Benedicto E., Francis M.B, & Tullman-Ercek D. (2018). Quantitative characterization of all single amino acid variants of a viral capsid-based drug delivery vehicle. Nature Communications, 9, 1385.

+ Open protocol

+ Expand

Plasmid Linearization by Restriction Digest

Check if the same lab product or an alternative is used in the 5 most similar protocols

One μg of the vector pSF-CMV-EMCV-NEO was digested in a 20 μl reaction with 1 μl each of XbaI and NcoI (FastDigest enzymes, Fermentas) in 1X FastDigest Green Buffer (Fermentas). The reactions were electrophoresed on a 0.8% agarose gel using TAE buffer. The bands that corresponded to the double digested vector were gel purified using the SV gel and PCR Cleanup Kit (Promega).

Trompeter N., Gardinier J.D., DeBarros V., Boggs M., Gangadharan V., Cain W.J., Hurd L, & Duncan R.L. (2021). Insulin-like Growth Factor-1 Regulates the Mechanosensitivity of Chondrocytes by Modulating TRPV4. Cell calcium, 99, 102467.

+ Open protocol

+ Expand

Pneumococcal DNA Isolation and ply Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pneumococcal strains (D39 laboratory strain and clinical isolates) were grown on blood agar plates at 37°C and 5% CO₂ for 8-10 hours. A sterile swab was used to transfer bacterial material into tubes containing 100μl phosphate buffered saline (PBS, pH 7.4). Bacteria were heated for 10 minutes at 98°C and afterwards centrifuged for 1 minute at 13.000 x g. 10 μL of the supernatant (containing chromosomal DNA) was used as template for the PCR reactions. To amplify the ply gene region (ply + approx. 250 bp up- and downstream) primer ply_check_f (5′ GAACTTTATGATAGAAGAGCCGG 3′) and primer ply_check_r (5′ GATATAAACAGCAAAATATTTCCG 3′) were used. Finally, PCR products were purified using a PCR-clean up kit (Promega).

Serra S., Iannotti V., Ferrante M., Tofiño-Vian M., Baxendale J., Silberberg G., Kohler T.P., Hammerschmidt S., Ulijasz A.T, & Iovino F. (2024). The single D380 amino acid substitution increases pneumolysin cytotoxicity toward neuronal cells. iScience, 27(4), 109583.

+ Open protocol

+ Expand

Verification of PCR Amplicons by Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-PCR was carried out in a Thermal Cycler (Applied Biosystems, Foster City, CA) in order to verify the three PCR amplicons (SsrA, RsaC and RNAIII) by agarose gel and DNA sequencing. The PCR was performed in a 20 μL reaction, containing gene-specific primers mentioned above and DreamTaq Green PCR Master Mix (Thermo Fischer Scientific, USA) according to the manufacturer's instruction. One μL of cDNA was used as the template. The cycling conditions were performed as follows: after an initial denaturation step of 2 min at 95 °C, 40 cycles were performed for 30 s at 95 °C, 60 s at 60 °C, and 1 min at 72 °C. A final extension step for 10 min at 72 °C was used. PCR products were further separated on a 1% agarose gel, stained with GelRed and visualized using Syngen Gel Imaging (Bio-Rad Laboratories Inc, USA). The PCR product was cleaned using PCR Clean-Up Kit (Promega, Norway). Sequencing reactions were performed in using a BigDye Terminator version 3.1 kit (Applied Biosystems) according to the manufacturer's instructions with the same primers as for the real-time PCR assay. Sequencing was performed on an Applied Biosystems 3,130 × l genetic analyzer.

Joshi B., Singh B., Nadeem A., Askarian F., Wai S.N., Johannessen M, & Hegstad K. (2021). Transcriptome Profiling of Staphylococcus aureus Associated Extracellular Vesicles Reveals Presence of Small RNA-Cargo. Frontiers in Molecular Biosciences, 7, 566207.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!