Nucleospin rna blood kit

Blood was collected in PAXgene blood RNA tubes (BD Biosciences, Franklin Lakes, NJ, USA). RNA was extracted from 2.5 mL whole blood using the NucleoSpin RNA Blood Kit according to the manufacturer’s instructions (support protocol for RNA isolation from whole blood; Macherey-Nagel, Düren, Germany). The concentration of RNA was determined by using the Qubit system (RNA High Sensitivity Assay Kit; Thermo Fisher Scientific, Waltham, MA, USA). RNA sequencing was performed using an Illumina Twist Exome 2.0 Plus on a NextSeq2000 Sequencing System (Illumina, San Diego, CA, USA) according to the manufacturer’s protocols. More detailed information on the protocols used is available upon request.

To identify the host genotype and to detect the microbial genomes in the peripheral blood cells, we extracted DNA and RNA from the blood clot. Subsequently, the RNA was converted to cDNA. We used a High Pure PCR Template Preparation Kit (Roche, Penzberg, Germany) for DNA extraction and a NucleoSpin RNA Blood kit (MACHEREY-NAGEL GmbH & Co. KG, Gueren, Germany) for RNA extraction. We immediately converted the extracted RNAs to cDNA with a Transcriptor First Strand cDNA Synthesis Kit (Roche, Penzberg, Germany). To synthesize cDNA, the RNA was denatured in a 13 μl cocktail containing 10 μl total RNA, 2 μl Random hexamer primers, and 1μl Anchored oligo (dT)18 primer at 65ºC for 10 minutes. Then, we added 0.5 μl Protector RNase Inhibitor, 0.5 μl Transcriptor Reverse Transcriptase, 2 μl dNTP Mix and 4 μl Transcriptor RT Reaction Buffer to the reaction mix. Finally, the reverse transcription reaction was performed in this 20 μl cocktail using the following conditions: pre-incubation at 25°C for 10 minutes, incubation at 50°C for 60 minutes, inactivation of Transcriptor Reverse Transcriptase at 85°C for 5 minutes, and storage at 4°C.

Total RNA was isolated from peripheral blood using the NucleoSpin RNA Blood Kit (Macherey-Nagel, Germany), according to the manufacturer’s instructions. RNA was reverse transcribed into complementary DNA (cDNA) using iScript™ Advanced cDNA Synthesis Kit for reverse transcription-quantitative real-time polymerase chain reaction (qPCR) (Bio-Rad,United States). cDNA was amplified by qPCR in the thermocycler QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, United States) using SsoAdvanced™ universal SYBR^® Green Supermix (Bio-Rad, United States). All samples were assayed in duplicate and experimental control assays were included. The relative VCAM1, CCL2 (gene enconding MCP-1) and PRMT1 (gene enconding the enzyme that catalyzes the ADMA synthesis reaction) mRNA expression was analyzed by the comparative Ct method using GAPDH as housekeeping gene.

Total RNA was isolated from peripheral blood using the NucleoSpin RNA Blood Kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany) according to the manufacturer’s instructions. RNA was reverse transcribed into complementary DNA (cDNA) using the iScript™ Advanced cDNA Synthesis Kit for reverse transcription-qPCR (Bio-Rad, Hercules, CA, USA). Then, cDNA was amplified using qPCR in the thermocycler QuantStudio^TM 7 Flex Real-Time PCR System with SsoAdvanced^TM Universal SYBR^® Green Supermix (Bio-Rad, Hercules, CA, USA). All samples were assayed in duplicate, and experimental control assays were included. Relative OPN mRNA expression was analyzed by the comparative Ct method using GAPDH as the housekeeping gene.

Total RNA was isolated from MSC using a Pure Link RNA Mini Kit (Ambion, USA) according to the manufacturer’s instructions. The isolation was supported by a DNAse digestion to remove genomic DNA using a PureLinkDNase Set (Invitrogen, USA). The total RNA from the blood samples was isolated using a NucleoSpin RNA Blood kit (Macherey-Nagel, Germany). Erythrocytes were degraded with the use of Red Blood Cell Lysis Buffer (Roche, Switzerland). The isolated RNA has been subjected to a qualitative and quantitative assessment using a NanoDrop spectrophotometer (NanoDrop, USA) and Bioanalyzer 2100 (Agilent Technologies, France). Information about the mean values of RNA is shown in Table 1.
Table 1

Mean values of RNA extracted from the MSC and whole blood of goats

Mean values	MSCa	Blood
Quantity [ng/μL]	167.88	69.41
A260/A280 ratio	1.98	1.82
A260/A230 ratio	1.44	1.20
RIN#	5.25	6.0

^aMSC – milk somatic cells; ^#RIN – RNA Integrity Number

Following this, 1 μg of RNA was reverse transcribed into cDNA using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland). cDNA samples were diluted to a volume of 50 ng and used in Real-time PCR analysis.

Leukocyte RNA isolation and purification were carried out using the ‘NucleoSpin RNA Blood’ kit manufactured by Macherey-Nagel (Fisher Scientific, Leicestershire, UK). For generation of cDNA, we used the ‘qscript cDNA synthesis’ kit by QuantaBio (Beverley, MA, US). Primers used for amplification were:

REXO2RT_F: GTAGGTGGGAGTCACGGACG

REXO2RT_R: CGGTAAAACTGAAGCTCTTTGATGC

Following 30 amplification cycles, the PCR products were separated on 3% agarose gel and visualized with ethidium bromide staining.

For whole blood cells, total RNAs were extracted using a commercial kit (NucleoSpin RNA blood kit; Macherey-Nagel) according to the manufacturer’s instructions. After a DNase treatment (DNA-free kit; Applied Biosystems, Foster City, CA, USA) in the presence of a RNase inhibitor (Thermo Fisher Scientific), the quality and amount of extracted RNA were estimated using a microvolume DS-11 spectrophotometer (DeNovix, Clinisciences, France). After a concentration step performed with a speed-vac concentrator (Thermo Fisher Scientific), only samples reaching the minimal required RNA concentration of 111 ng/µL were used. For both adipose tissues, total RNAs were extracted using RNeasy Lipid Tissue Mini Kit (Qiagen, France) according to the manufacturer’s instructions, and were quantified using the DS-11 spectrophotometer. The integrity of extracted total RNA from whole blood cells and adipose tissues was assessed using the RNA 6000 Nano kit (Agilent Technologies, Paris, France) with the Agilent 2100 Bioanalyzer (Agilent Technologies) and samples meeting quality criteria were kept for further analyses. Ratios of A260/280 and A260/230 were greater than 1.6. RNA integrity numbers were between 7.0 and 10.0.