The largest database of trusted experimental protocols

Ad nc

Manufactured by Hanbio Biotechnology
Sourced in China

Ad-NC is a laboratory instrument designed for the adenoviral infection of cells. It is used to facilitate the transduction of target cells with adenoviral vectors, enabling the introduction of desired genetic material into the cells. The core function of Ad-NC is to provide a controlled environment and streamlined process for adenoviral cell transduction.

Automatically generated - may contain errors

6 protocols using ad nc

1

Investigating AUF1 Function in Skin Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To explore the function of AUF1 in skin cells, overexpression and RNA interference experiments were carried out. AUF1 complementary (c)DNA was obtained from OriGene Technologies, Inc. (cat. no. SC107836). AUF1 cDNA was subcloned into the pHBAD-EF1-mcs-CMV vector (Hanbio Biotechnology Co., Ltd.) for adenovirus construction. Packaging and purification of adenovirus overexpressing AUF1 (Ad-AUF1) and negative control adenovirus (Ad-NC) were carried out by Hanbio Biotechnology Co., Ltd. AUF1 cDNA was also subcloned into the pHBLV-U6-ZsGreen-Puro vector for lentivirus construction. Lentiviruses targeting AUF1 [named short hairpin (sh)AUF1-1 and shAUF1-2, respectively] and a scrambled negative control lentivirus (sh-NC) were purchased from Hanbio Biotechnology Co., Ltd. The target sequences against AUF1 are listed in Table SI. A mock-infected control group (without vector) was also constructed to demonstrate the background expression value.
HaCaT and WS1 cells were cultured in a six-well culture plate. After reaching 70% confluence, the cells were both infected with adenoviruses and lentiviruses at a multiplicity of infection of 20 with DMEM free-serum for 6 h at 37˚C in 5% CO2. After 48 h, the cells were harvested for further experiments, and the efficiency of infection was determined by reverse transcription-quantitative PCR (RT-qPCR) and western blotting.
+ Open protocol
+ Expand
2

Modulating METTL3, RAGE, Glo-1, and MafA with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNAs (siRNAs) targeting METTL3 (si-METTL3), the receptor for advanced glycation end products (RAGE, si-RAGE), glyoxalase 1 (Glo-1, si-Glo-1), and MafA (si-MafA), as well as a negative control siRNA (si-NC), were synthesized by Riobio Technology Co. (Guangzhou, China). The siRNA sequences were as follows:
Lipofectamine 3000 reagent (Invitrogen, California, USA), Opti-MEM medium (Gibco, California, USA), and siRNAs were mixed and incubated at room temperature for 15 min and then added to cells and incubated for 36 h. Three siRNA sequences were synthesized for each target gene, and the siRNA targeting METTL3-2, RAGE-1, Glo-1-2, and MafA-3 with the highest inhibition efficiencies were selected for subsequent experiments (Supplementary Figure S1).
Recombinant adenovirus constructs with either METTL3 (Ad-METTL3) or an empty vector (Ad-NC) and pCDNA3.1 plasmids carrying either MafA (pCDNA-MafA) or the empty vector (pCDNA) were synthesized by HanBio Technology Co. (Shanghai, China). Cells were infected with Ad-NC or Ad-METTL3 for 48 h. Cells were transfected with pCDNA or pCDNA-MafA using Lipofectamine 3000 reagent (Invitrogen, California, USA) for 48 h.
+ Open protocol
+ Expand
3

Overexpression of AK006774 Using Adenoviruses

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adenoviruses overexpressing AK006774 (Ad-AK006774) and control vector (Ad-nc) were synthesized by Hanbio (Shanghai, China). The miR-448 mimic and inhibitor, along with their negative controls, were synthesized by General Bio Company (Hefei, Anhui). Wild-type and mutant sequences containing the binding sites of miR-448 targeting AK006774 and bcl-2 were synthesized and cloned into the pGL3 reporter plasmid (Promega, USA). These oligonucleotides were transfected into cells using Lipofectin2000 (Thermo Fisher Scientific), USA kit according to the instructions [14 (link)].
+ Open protocol
+ Expand
4

Functional Validation of CDR1as Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Specific siRNAs were constructed by GenePharma Co., Ltd., of China. Their sequences were as follows: hsa-miR-135b-5p inhibitor: UCACAUAGGAAUGAAAAGCCAUA (antisense 5’-3’), negative control (NC) inhibitor: UUGUACUACACAAAAGUACUG (antisense 5’-3’), Si-CDR1as: GCAAUAUCCAGGGUUUCCGTT (sense 5’-3’) and CGGAAACCCUGGAUAUUGCTT (antisense 5’-3’), Si-NC: UUCUCCGAACGUGUCACGUTT (sense 5’-3’) and ACGUGACACGUUCGGAGAATT (antisense 5’-3’). These siRNAs were transfected into HO8910 and A2780 cells using Lipofectamine 2000 siRNA transfection reagent according to the manufacturer’s instructions. Ad-CDR1as and Ad-NC were designed and synthesized by Hanbio (China). Adenovirus particles were used according to the manufacturer’s instructions. To measure the overexpression efficiency of adenovirus-targeted CDR1as, quantitative polymerase chain reaction (qPCR) was used.
+ Open protocol
+ Expand
5

Modulation of hippocampal miRNA and BDNF

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-34b-5p and miR-470-5p overexpressing adenovirus vectors (Ad-miR-34b-5p and Ad-miR-470-5p) and their controls (Ad-miR-NC), BDNF overexpressing adenovirus vector or short guide RNA (sgRNA) adenovirus vector (Ad-BDNF and sg-BDNF) and their controls (Ad-NC and sg-NC) were constructed from Hanbio (Shanghai, China). CUMS mice were anesthetized by intraperitoneal injection of 10% chloral hydrate (4 mL/kg, Sigma-Aldrich, St. Louis, MO, USA) and fixed on a stereotactic instrument. A 0.5 mm diameter drill was used to open the skull on both sides of the mice. Subsequently, the adenovirus vectors (1011 pfu/mL, 1 µL) were slowly injected into the hippocampus using a glass microtube fixed on the stereotaxic instrument. After the operation, the mice were taken out of the stereotaxic instrument and placed in a warm cage to recover. On the third day after the operation, 20 mg/kg/day Berberine (dissolved in normal saline; Guangrui Bio, Shanghai, China) was administered by gavage. 2 weeks after the surgery, the mice were subjected to behavioral tests. In addition, the mice were euthanized and their hippocampus tissues were taken to detect the expression of miRNA and BDNF.
+ Open protocol
+ Expand
6

Adenoviral METTL14 Overexpression in NIT-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The recombinant adenovirus vectors encoding the empty vector (Ad-NC) and METTL14 overexpression construct (Ad-METTL14) were synthesized by HanBio (Shanghai, China). NIT-1 cells were transfected with Ad-NC or Ad-METTL14 at a multiplicity of infection (MOI) of 100. After incubating in the transfection medium for 6–8 h, the medium was replaced, and subsequent experiments were conducted.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!