Odissey scanner
The Odyssey scanner is a multimode microplate reader that can be used for a variety of fluorescence-based applications. It is capable of detecting both visible and near-infrared fluorescence signals. The Odyssey scanner provides high-sensitivity detection and can be used for a range of sample types, including cell-based assays, protein gels, and Western blots.
Lab products found in correlation
3 protocols using odissey scanner
Synaptosomal Protein Quantification and Immunoblotting
Western Blot Analysis of LIGHT and RANKL
Primer Elongation Assay for Firefly Luciferase
cells using Trizol. Primer elongation has been performed as already
described.63 (link) Briefly, 5
µg of total RNA were retrotranscribed using the RevertAid H minus first
strand cDNA synthesis kit (Thermo Fisher Scientific) and a reverse IR-Dye
700 conjugated oligo (IDT technology, Coralville, IA) GTGATTCCACAGCCATGGTG
specific for the firefly luciferase sequence. Samples were then separated on
a 6% tris-borate-EDTA-Urea gel (Thermo Fisher Scientific) and the gel was
acquired using an Odissey scanner (Li-Cor Biosciences)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!