The plasmid was curated from Eco_b1 through prolonged incubation in ethidium bromide (EtBr 1%, AppliChem, Germany). Overnight cultures of Eco_b1 were suspended in PBS at McF of 1.0 diluted in PBS 1:10 000 and then 1:10 in LB broth (BioFroxx, Germany). EtBr was added in concentrations of 0.1–1 µg/mL and bacteria were incubated with shaking for 48 h. Vials displaying visual growth were diluted in PBS, plated on Columbia blood agar, incubated at 36 °C overnight and transferred onto both Columbia blood agar (BD, Germany) and ESBL agar (Biomérieux, Germany). After overnight incubation at 36 °C, bacterial colonies with phenotypic loss of resistance, as indicated by growth only on Columbia blood agar but not on ESBL agar, were subjected to PCR for hha to confirm removal of the hha-containing IncFII_1 plasmid. PCR for hha was carried out with Mytaq HS Polymerase Red (BioLine, meridian, USA) according to the manufacturer’s protocol. PCR was performed with the following primer sequences: hha fw ATGGCGAAAACAAAACAGGA, rev CCGGTGATTAATTCCGCTAA; and cycling conditions: 95 °C for 1 min, 30 cycles of: 95 °C for 15 sec, 60 °C for 15 sec, 70 °C for 10 sec. PCR products were visualized in 1.5% agarose gel.
Columbia blood agar
Manufactured by BD
Sourced in Germany, United States
Columbia blood agar is a general-purpose growth medium used in microbiology laboratories to isolate and culture a variety of microorganisms, including both aerobic and anaerobic bacteria. It contains nutrients essential for the growth of a wide range of microbes and is supplemented with sheep blood to support the growth of fastidious organisms.
Automatically generated - may contain errors
Lab products found in correlation
Chocolate agar, by BD (3 mentions)
Api system, by bioMérieux (2 mentions)
Macconkey agar, by Thermo Fisher Scientific (2 mentions)
Lb broth, by BD (2 mentions)
Maldi tof mass spectrometry, by Bruker (2 mentions)
Maldi tof, by Bruker (2 mentions)
Vitek 2 automated system, by bioMérieux (2 mentions)
Macconkey agar, by bioMérieux (2 mentions)
Maldi tof ms, by Bruker (2 mentions)
Macconkey agar, by BD (2 mentions)
O and h antisera, by Statens Serum Institut (2 mentions)
Vitek 2 system, by bioMérieux (2 mentions)
Gaspak anaerobic system, by Mitsubishi (2 mentions)
Microflex lt system, by Bruker (1 mentions)
Trypticase soy broth (tsb), by BD (1 mentions)
Phenol red, by Lonza (1 mentions)
Rpmi 1640 medium, by Lonza (1 mentions)
Genequant, by Cytiva (1 mentions)
Bacto yeast extract, by BD (1 mentions)
Esbl agar, by bioMérieux (1 mentions)
48 protocols using columbia blood agar
1
Plasmid Curation via Ethidium Bromide
2
Enrichment and Identification of Polywipe Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To enrich the bacteria within the Polywipes®, 50 mL of CASO broth containing TLHC (tryptic soil broth with neutralizers, Merck KGaA, Darmstadt, Germany) was added to each cloth. The contained detergents (3% tween, 0.3% lecithin, 0.1% histidine, and 0.1% cysteine) inactivate any present disinfectants. The broth was incubated at 37 °C for 24 h. Then, 100 µL of the broth was streaked onto Columbia blood agar (with 5% sheep blood, Becton Dickinson, Franklin Lakes, NJ, USA) and Drigalski lactose agar (OXOID Deutschland GmbH, Wesel, Germany). The plates were incubated at 37 °C for 48 h.
The rectal and pharyngeal swabs from the neonates were streaked onto Columbia blood agar (with 5% sheep blood, Becton Dickinson, USA) and Drigalski-lactose agar (OXOID Deutschland GmbH, Germany). The plates were incubated at 37 °C for 48 h.
All relevant colonies from wipes and swabs were isolated, identified with MALDI-TOF (Vitek MS, BioMerieux Deutschland, Nuertingen, Germany), and sampled for sequencing.
The rectal and pharyngeal swabs from the neonates were streaked onto Columbia blood agar (with 5% sheep blood, Becton Dickinson, USA) and Drigalski-lactose agar (OXOID Deutschland GmbH, Germany). The plates were incubated at 37 °C for 48 h.
All relevant colonies from wipes and swabs were isolated, identified with MALDI-TOF (Vitek MS, BioMerieux Deutschland, Nuertingen, Germany), and sampled for sequencing.
3
Identification of Acinetobacter baumannii Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The isolates were identified by matrix-assisted laser desorption/ionization—time-of-flight mass spectrometry (MALDI-TOF MS) using the Microflex LT system and the MALDI Biotyper Compass v.4.1.80 software (Bruker Daltonics, Hamburg, Germany). The values known for Acinetobacter representatives were used as a criterion for reliable species identification score ≥ 2.0 according to manual. The species identification of A. baumanii isolates was confirmed by detection of species-specific blaOXA-51-like genes using real-time PCR with commercial kits “AmpliSensR MDR Ab-OXA-FL” (Central Research Institute of Epidemiology, Moscow, Russia) and the DTPrime 5X1 system (DNA-Technology, Moscow, Russia). Prior to analysis, the isolates were stored at −70 °C in trypticase-soy broth (BD, Sparks, MD, USA) supplemented with 30% glycerol. The obtained strains from local laboratories were revived on Columbia blood agar (BD, USA) aerobically at 36 ± 1 °C.
4
Culturing and Characterizing P. multocida Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The laboratory and clinical isolates of P. multocida used in this study and their sources are described in Table S1 . Strain C0513 was isolated from the transtracheal wash of a calf following an experimental challenge (22 (link)) with H. somni. Prior to the challenge, nasopharyngeal cultures from the calf were negative for P. multocida and other respiratory pathogens. All P. multocida strains were cultured on brain heart infusion (BHI) or Columbia blood agar (BD, Franklin Lakes, NJ) supplemented with 5% defibrinated sheep blood (HemoStat Laboratories Inc., Dixon, CA) or on DSA with or without 0.005% CR supplementation. Agar-grown cultures were grown at 37°C with 6% CO2. Broth cultures were grown in BHI or RPMI 1640 medium without glutamine or phenol red (Lonza, Walkersville, MD). For biofilm formation, 50 μl of mid-log-phase P. multocida was inoculated into 5 ml of RPMI 1640 in a 50-ml polyethylene tube and incubated without shaking at 37°C in 6% CO2 for at least 48 h.
All P. multocida isolates were confirmed and serogrouped by multiplex PCR as described elsewhere (73 (link)). All of the isolates used in this study were nontoxigenic and either serogroup A or F or untypeable (not A, B, D, E, or F).
All P. multocida isolates were confirmed and serogrouped by multiplex PCR as described elsewhere (73 (link)). All of the isolates used in this study were nontoxigenic and either serogroup A or F or untypeable (not A, B, D, E, or F).
5
Preparation of Streptococcus pneumoniae Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sp clinical isolate 19F was plated on Columbia blood agar (BD Biosciences, San Jose, CA, USA) and kept at 37 °C with 5% CO2 overnight. The single colonies were removed by a sterile cotton swab and transferred to autoclaved pre-warmed Todd Hewitt broth medium (Sigma-Aldrich GmbH, Taufkirchen, Germany) supplemented with Bacto Yeast extract (BD Biosciences, San Jose, CA, USA). The initial optical density (OD) of the inoculated broth was measured with a spectrophotometer (GeneQuant, Amersham Biosciences, Freiburg, Germany) and set at ~0.09. The bacteria were grown until mid-log phase point equivalent to an OD600 of 0.2–0.3 in the generated growth curve (Figure S1 ). The multiplicity of infection (MOI) was adjusted based on the repetitive measurement of colony formation unit (CFU) per ml of mid-log phase Sp stock. Before each experiment, the bacterial stock was prepared separately, by washing the bacterial stock three times in cold 1X PBS (Gibco, Life Technologies, Paisley, UK) and centrifuging at 14,000× g at 4 °C. The bacterial pellets were then resuspended in 1 mL antibiotic-free MEM.
6
Surveillance of Multidrug-Resistant Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The University Hospital Münster (UHM) is a 1,300-bed tertiary care center in Münster, Germany, admitting on average 55,000 patients per year. Bacterial samples were collected from hospitalized patients at the UHM for an 18-month time period from January 2022 to June 2023 as part of the routine hospital surveillance of multi-drug-resistant bacteria (MDRBs) according to national recommendations (Bundesgesundheitsblatt, 2012 (link)). Screening specimens were cultivated on chromID ESBL Agar (biomérieux, Marcy-l’Etoile, France) and incubated at 36°C ± 1°C for 18 to 24 h. Clinical specimens were cultivated on Columbia Blood agar with 5% Sheep Blood (BD, Heidelberg, Germany; aerobic incubation at 35°C ± 2°C ambient air for up to 3 days), and MacConkey selective agar for Gram-negative bacteria (MacConkey II Agar, BD, Heidelberg, Germany; aerobic incubation at ambient air 35°C ± 2°C for up to 2 days) if applicable. During the study period, >500 MDRB Enterobacteriaceae isolates were identified.
7
Isolation and Cultivation of Clinical Bacterial Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolates were obtained from clinical specimens as outlined in Table 1 . Isolates were maintained at -80C in 10 % skim milk for long term storage. Samples were grown on solid media including Columbia blood agar (CBA), Colombia CNA agar (CNA), mannitol salt agar (MSA), and trypticase soy agar supplemented with 3 % yeast extract (TSY), all from BD Diagnostics, Canada as well as, fastidious anaerobic agar (FAA, Neogen Acumedia, USA). Difibrinated sheep’s blood (Dalynn Biologics, Canada) was added to a 5 % final volume for CBA, CNA, and FAA. Isolates were cultivated at 37 °C with 5 % CO2 or in a Ruskinn Concept 400 anaerobic chamber (Ruskinn, Bridgend, UK) with 80 % N, 10 % CO2 10 % H2.
8
Reactivation of B. bacilliformis Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three B. bacilliformis strains from the Institute Pasteur (Paris, France) collection were used (Table 5 ). The strains were reactivated following the instructions of the Institute Pasteur. Briefly, after opening, 0.2 ml of LB was added to the vial to resuspend the bacteria. Thereafter, the suspension was spread onto Columbia blood agar (Ref: 254005, BD, Heidelberg, Germany) and incubated at 28 °C. The plates were inspected weekly until bacterial growth was observed. Prior to the development of the antibiotic resistant mutants, the bacterial identity of all three isolates was confirmed by amplification and sequencing of the 16S rRNA gene (Table 6 )59 (link).
9
Cultivation and Selection of S. aureus and E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cultivation of S. aureus, tryptic soy agar (TSA; BD, Heidelberg, Germany), Columbia blood agar (BD), Mueller-Hinton agar (heipha Müller GmbH, Eppelheim, Germany), brain heart infusion (BHI) broth (Merck, Darmstadt, Germany), chemical-defined medium, and Luria-Bertani (LB) broth (BD) were used. For cultivation of E. coli, LB broth and agar (BD) were used. Selection for resistance to antibiotics in E. coli or S. aureus was performed with ampicillin (100 µg/ml), erythromycin (2.5 µg/ml), and chloramphenicol (10 µg/ml) (AppliChem GmbH, Darmstadt, Germany).
10
Convenience Sample Selection for S. aureus Sera
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A convenience sample of 11 sera per study site was considered appropriate as described previously [19 (link)]. A specific sample size calculation was not performed.
All sera were obtained from healthy volunteers without signs or symptoms of S. aureus infection. Participants were screened for nasal and pharyngeal S. aureus colonization. Briefly, the mucous membranes of the anterior nares and throat were swabbed (Transwab Amies, Medical Wire, Corsham, UK) with light pressure and cultured on Columbia blood agar (BD, Heidelberg, Germany). S. aureus was confirmed by MALDI-TOF mass spectrometry (Bruker, Bremen, Germany). Demographic and clinical data (age, sex, hospitalization, use of antibiotics, history of skin and soft tissue infection, known HIV infections) were recorded in standard case report forms.
All sera were obtained from healthy volunteers without signs or symptoms of S. aureus infection. Participants were screened for nasal and pharyngeal S. aureus colonization. Briefly, the mucous membranes of the anterior nares and throat were swabbed (Transwab Amies, Medical Wire, Corsham, UK) with light pressure and cultured on Columbia blood agar (BD, Heidelberg, Germany). S. aureus was confirmed by MALDI-TOF mass spectrometry (Bruker, Bremen, Germany). Demographic and clinical data (age, sex, hospitalization, use of antibiotics, history of skin and soft tissue infection, known HIV infections) were recorded in standard case report forms.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!