The largest database of trusted experimental protocols

Sictrl

Manufactured by Eurofins

The SiCtrl is a laboratory equipment product offered by Eurofins. It is designed for precise control and monitoring of silicon-based materials and processes. The core function of the SiCtrl is to provide accurate measurement and regulation of parameters relevant to silicon-based applications.

Automatically generated - may contain errors

4 protocols using sictrl

1

Transient siRNA Knockdown in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were grown in DMEM GlutaMax (Invitrogen) supplemented with 10% FCS (FCS Superior, Biochrom KG) and 1% penicillin/streptomycin solution (Invitrogen) at 37°C with 5% CO2. Cells were split into six-well plates and transfected with 50 pmol siRNAs and 5 µL of Lipofectamine RNAiMax (Invitrogen) per well 1–3 d later, depending on their initial density, at ∼50%–90% confluency (day 1). The following siRNAs were used: siCtrl (UGGGCGUCGUGGAGGCUUUTT, Eurofins MWG Operon), siPABPN1_b (GGAGCUACAGAACGAGGUATT, Eurofins MWG Operon), and siPABPN1_8 (CCCAAAGGGUUUGCGUAUAUA, Qiagen #SI04763577). After 4–6 h incubation, the cells were split to three or four wells. On day 3, the siRNA treatment was repeated. Cells derived from one original well were combined and spread on a 6-cm or 10-cm dish for protein or RNA preparation, respectively. For 4-thiouridine (4-sU) labeling, the medium was renewed on day 4. On day 5 (∼96 h after the first transfection), cells were treated for 10 or 30 min with 500 µM 4-thiouridine (Sigma-Aldrich) or not. Total RNA was isolated by a modified TRIzol method (Chomczynski and Mackey 1995 (link)).
+ Open protocol
+ Expand
2

Targeted Downregulation of TAZ Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to downregulate TAZ expression, we transfected cells with small interfering RNA (siRNA) designed to target human TAZ. The siRNA suspension was composed of Lipofectamine RNAiMAX (Thermo Fisher Scientific), OptiMEM medium (Thermo Fisher Scientific), and 20 nM of siRNA. Experiments were performed with three different siRNA that target TAZ: siTAZ1 (5′- ACGUUGACUUAGGAACUUU-3′, Eurofins, Dortmund, Germany) [47 (link)], siTAZ2 (5′-AGGUACCUUCCUCAAUACA-3′, Eurofins) [47 (link)], and siTAZ3 (5′-UGUGGAUGAGAUGGAUACA-3′, Eurofins). siTAZ1 and siTAZ2 are specific of TAZ sequences. siTAZ3 recognizes a common sequence of both TAZ and YAP mRNA. A negative control siCtrl (siCtrl 5′-GGGCAAGACGAGCGGGAAG-3′, Eurofins) with no known homology to mammalian genes was used. Two rounds of siRNA transfection were performed (separated by 24 h) in medium without antibiotics. Co-culture experiments were performed 6 h after the last transfection. Analyses were performed 30 h after the last transfection and 24 h after infection [13 (link),30 (link)]. TAZ inhibition efficiency was evaluated by Western blot experiments.
+ Open protocol
+ Expand
3

Transfection and RNAi in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells were transfected with mammalian expression plasmids using Lipofectamine 3000 (#L3000015, Thermo Fisher Scientific) according to the manufacturer’s instruction. For RNA interference, HT29 cells were transfected with 50 nM validated siRNAs (Ambion) directed against MAPK14 using the HiPerfect reagent (#301704, QIAGEN) according to the manufacturer’s instructions. siCTRL (Eurofins) was used as a non-silencing control. siRNA sequences are listed in Supplementary Table 1.
+ Open protocol
+ Expand
4

Probing PP2A-Mediated Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
siCtrl (#1): AllStars Neg. Control siRNA, Cat. No./ID: 1027281 (QIAGEN), siCtrl (#2): CGUACGCGGAAUACUUCGA (Eurofins), siPP2A-A: UUUUCCACUAGCUUCUUC A (Eurofins), siHRAS: GAACCCUCCUGAUGAGAGU (Eurofins), siKRAS: AGAGUGCCUUGACGAUACA (Eurofins), siNRAS: GAAAUACGCCAGUACCGAA, siPME (#1): GGAAGUGAGUCUAUAAGCA, siPME-1 (#2): UCAUAGAGGAAGAAG AAG A, siSET (#1): UGCAGACACUUGUGGAUGG (Eurofins), and siSET (#2): AAUGCA GUGCCUCUUCAUC (Eurofins). All siRNAs (CHD3, DNMT1, DOT1L, KDM1A, MLLT3, RNF168, and SMARCA4) for the cell viability assay were ordered from QIAGEN. AllStars Hs Cell Death siRNA, Cat. No./ID: 1027299 (QIAGEN), was used as a positive control (siCtrl +).
DNMT1 inhibitors (decitabine; AZA), BET inhibitors (iBET151, JQ1, mivebresib), HDAC inhibitors (panobinostat; TSA), KDM1A inhibitors (SP2509), and okadaic acid were used and purchased from SelleckChem. PP2A-reactivating compound DBK1154 was a kind gift of Dr. Michael Ohlmeyer (Atux Iskay; LCC).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!