Phusion pcr kit

DNA was extracted from a domestic drain metagenome and sequenced using the Illumina MiSeq platform.52 Predicted protein sequences from the drain metagenome were previously functionally annotated by scanning the sequences against Pfam28.0 libraries of domain families (pfam.xfam.org). To identify putative ω-transaminases, sequences annotated with the Pfam domain family: aminotransferase class-III (PF00202) were retrieved. Of 77 sequences, 36 were judged to be full-length, non-redundant proteins by methods previously described.34 ,35 The genes of interest were amplified by PCR from the metagenome DNA using NEB Phusion PCR kit or NEB Q5 High-Fidelity kit. PCR products were visualised by gel electrophoresis, isolated via Qiagen Gel extraction columns and cloned into pET-28a(+) with the C- and N-terminal His6-tag for pQR2188–pQR2199 using the restriction enzymes NdeI and XhoI and pET-29a(+) with the C-terminal His6-tag for pQR2200–pQR2216 (ESI, section 4†). In all cases, recombinant plasmids were transformed into E. coli TOP10, then isolated and verified by sequencing before transformation into E. coli BL21 (DE3).

Cells (about 1 × 10⁶ from each cell type) with or without stimulation by 400 ng PMA LPS for 24 h or of 10 ml whole blood were harvested and homogenized; total RNA was isolated using the PAX gene blood RNA kit (QiaGen). A 20 ng of isolated RNA was transcribed into cDNA using QuantiTect® Reverse Transcription Kit (QiaGen). cDNA was amplified using Phusion PCR Kit (New England Biolabs), and primers situated in exon 1 (5′TCGGTGGTTCCTGTGTCCTTCATT3′) and exon 2 (5′TCACCTTGCTGCAGTGTGGATGAT3′) of ARMS2 or for amplification of actin (forward 5′ACCAACTGGGACGACAT3′; reverse 5′CTAGAAGCATTTGCGGTG3′). Synthesis was performed by denaturing for 60 s at 96 °C followed by annealing for 30 s at 69 °C (ARMS2) or 60 °C (actin) and synthesis for 60 s (ARMS2) or 120 s (actin) at 72 °C for 35 cycles. Extension was performed for 480 s at 72 °C. Amplified PCR products were separated in agarose and visualized under UV light. Bands were excised, purified, and sequenced on an automated DNA sequencer (ABI/1130x, Applied Biosystems). Sequences were aligned to ARMS2 genomic sequences (NM_001099667).

All genes were amplified using the specific cloning primers described below, using a Phusion PCR kit (New England Biolabs), according to the manufacturer’s specifications. Genes were then cloned into either shuttle vector pAdLoxP and pAdLoxP-WPRE or the expression vector pCAN-HA using standard techniques. pCAN-HA constructs were then subcloned into the pAdLoxP- and pAdLoxP-modified shuttle vectors. Each shuttle vector was then digested using the restriction enzyme SfiI and ethanol extracted, in preparation for cotransfection with Ψ5 viral DNA as previously described.