Faststart taqman probe master mix

Each pool, containing the corresponding of 5 digestive tracts of dissected R. prolixus, were pretreated for 2 h at 56°C with 100 μl lysis buffer containing 10 mM Tris-HCl (pH 9.2), 1 mM EDTA and 150 μg/ml proteinase K (Sigma-Aldrich, St. Louis, MO, USA). DNA was purified from the lysate using QIAamp DNA mini kit (Qiagen, Hilden, Germany) and resuspended from the silica column in a final volume of 100 μL of elution buffer from the kit [11 (link)]. DNA was stored at– 20°C until further analysis.
Multiplex qPCR reactions were carried out in a final volume of 20 μl, containing 2 μl DNA (8–10 ng), 2× FastStart TaqMan Probe Master Mix (Roche applied science, Mannheim, Germany), 600 nM cruzi1/cruzi2 primers and 250 nM Cruzi3 probe (FAM/NFQ-MGB) targeting T. cruzi nuclear satellite DNA (SAT-DNA), 300 nM P2B primer, 500 nM P6R primer and 150 nM Triat Probe (VIC/NFQ-MGB) (Applied Biosystems) targeting the 12S ribosomal subunit gene of triatomines [11 (link),19 (link),22 (link)]. Sequences of both sets of primers and probes are presented in Table 1. The cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 58°C for 1 min. Amplifications were performed in the ABI Prism 7500 Fast (Applied Biosystems).

RNA isolation and cDNA synthesis were performed using the μMACS One-step cDNA Kit (Miltenyi Biotech) according to the manufacturer’s instructions. Synthesized cDNA was eluted from the column and collected with 50 μl cDNA Elution Buffer for quantitative real time PCR (qRT-PCR). Reactions were performed in duplex, using GAPDH as the control gene, in a 384 well plate with FastStart TaqMan® Probe Master Mix (Roche). All reactions were performed on a Light Cycler 480 (Roche) and analysed using the Light Cycler® 480 SW 1.5 software. The following TaqMan primer/probe sets were used (Life Technologies); GAPDH Hs02758991_g1 (VIC), TBX21 Hs00203436_m1 (FAM), RORC Hs01076122_m1 (FAM), IFNG Hs00989291_m1 (FAM), IL17A Hs00174383_m1 (FAM). Relative gene expression (R) was analysed as 2^{−[ ΔCt sample − ΔCt control]}.

DU-145 cells (untreated, DMOG treated and BA + DMOG treated) were collected in RNA Protect Cell Reagent (Qiagen, West Sussex, UK) and stored at −80 °C until RNA extraction, using the RNeasy Minikit as per the manufacturer’s instructions (Qiagen). DNase treatment and reverse transcription were both performed using the Quantitect Reverse Transcription kit (Qiagen). Approximately 1 ug of RNA was reverse transcribed into cDNA as per protocol. Quantitative RT-PCR was performed using the FastStart Taqman probe master mix (Roche) on a PTC-200 thermocycler (Bio-Rad) according to manufacturer’s instructions. Primers were designed using the Universal Probe Library Assay Design Centre (Roche). HPRT-1 (Forward); gaccagtcaacaggggacat, HPRT-1 (Reverse); gtgtcaattatatcttccacaatcaag (Probe 22). HK II (Forward); tcccctgccaccagacta, HK II (Reverse); tggacttgaatcccttggtc (Probe 54).

Total RNA was extracted from mouse quadriceps muscles using Trizol (Sigma-Aldrich). cDNA was synthesized from extracted RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Bio Systems). Quantitative PCR was carried out on a 7500 Real-Time PCR System (Applied Biosystems) using FastStart TaqMan Probe Master Mix (Roche) and gene specific primers for AR (universal probe library #58, Roche; 5′ primer: ccagtcccaattgtgtcaaa; 3′ primer: tccctggtactgtccaaacg) and Cpsf2 (Mm00489754_m1, Applied Biosystems). Relative AR expression was determined by the standard curve method and normalized to Cpsf2.

To assay mRNA expression, total RNA was extracted from cells using the Nucleospin RNAII kit (Macherey-Nagel). One microgram of RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad). RT-QPCR was performed using a Light-Cycler 480 (Roche Applied Science) and the FastStart TaqMan Probe Master Mix (Roche Applied Science). The primers and probes (Universal Probe Library, Roche Applied Science) used are indicated on S1 Table.