Nf ya antibody

ChIP assay was performed according to the manufacturer’s protocol for the EZ‐ChIP^TM assay kit (#17‐371, Millipore). The amount of precipitated DNA was calculated as 10% of the input sample in triplicate. In brief, 20 μL NF‐YA antibody (#sc‐17753, Santa Cruz) and 40 μL SOX2 antibody (#sc‐17320, Santa Cruz) were validated to immunoprecipitate the chromatin DNA cross‐linked complex with 1% formaldehyde with the normal mouse IgG and Histone H3 rabbit monoclonal antibodies as the negative and positive control, respectively. Regions of interest were amplified from precipitated samples by real‐time PCR. Each sample was assayed in triplicate, and the amount of precipitated DNA was calculated as a percentage of the input sample. The primers used in quantitative ChIP assays are as follows: Forward: 5’‐AGGGGATACAAAGGTTTCTCAGTG‐3’, Reverse: 5’‐GGCTGTCAGGGAATAAATGGG‐3’.

The process of immunohistochemical staining was performed as in our previous study [19 (link)]. Briefly, TMA slides were dewaxed using xylene 10 min and graded ethanol. Then, antigen retrieval was performed using citric acid buffer (pH = 6.0) for 20 min. The sections were treated in 3% H₂O₂ for 5 min to eliminate endogenous peroxidase activity. The sections were subsequently incubated with rabbit anti-CDCA8 polyclonal antibodies (1:100 dilution; Santa Cruz, sc-376635) or NF-YA antibody (1:100 dilution; Santa Cruz, sc-17753) overnight at 4 °C and then treated with secondary antibodies for 1 h at 37 °C. Then, these sections were stained with DAB for 5 min in the dark, and 100% hematoxylin was introduced to react for 2 min. Finally, slides were dehydrated with graded alcohol, sealed with neutral balsam, and visualized and scanned with CaseViewer2.4 and Quant Center2.1 (3DHISTECH, Hungary).